ID: 942555813

View in Genome Browser
Species Human (GRCh38)
Location 2:177171268-177171290
Sequence GAGGGATGTTAGCATGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942555799_942555813 28 Left 942555799 2:177171217-177171239 CCCTGAACAGTAGAAGTTATGGG No data
Right 942555813 2:177171268-177171290 GAGGGATGTTAGCATGTGCAGGG No data
942555801_942555813 27 Left 942555801 2:177171218-177171240 CCTGAACAGTAGAAGTTATGGGT No data
Right 942555813 2:177171268-177171290 GAGGGATGTTAGCATGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942555813 Original CRISPR GAGGGATGTTAGCATGTGCA GGG Intergenic
No off target data available for this crispr