ID: 942558646

View in Genome Browser
Species Human (GRCh38)
Location 2:177198147-177198169
Sequence CAGCTCGGACAGCTTGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942558646_942558656 11 Left 942558646 2:177198147-177198169 CCAACGCCAAGCTGTCCGAGCTG No data
Right 942558656 2:177198181-177198203 GCAGCGGGCCAAGCAAGACATGG 0: 1
1: 14
2: 9
3: 34
4: 154
942558646_942558652 -5 Left 942558646 2:177198147-177198169 CCAACGCCAAGCTGTCCGAGCTG No data
Right 942558652 2:177198165-177198187 AGCTGGAGGCGGCCCTGCAGCGG 0: 1
1: 15
2: 15
3: 60
4: 348
942558646_942558657 16 Left 942558646 2:177198147-177198169 CCAACGCCAAGCTGTCCGAGCTG No data
Right 942558657 2:177198186-177198208 GGGCCAAGCAAGACATGGCATGG 0: 1
1: 2
2: 11
3: 37
4: 276
942558646_942558653 -4 Left 942558646 2:177198147-177198169 CCAACGCCAAGCTGTCCGAGCTG No data
Right 942558653 2:177198166-177198188 GCTGGAGGCGGCCCTGCAGCGGG 0: 1
1: 17
2: 16
3: 75
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942558646 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG (reversed) Intergenic
No off target data available for this crispr