ID: 942564563

View in Genome Browser
Species Human (GRCh38)
Location 2:177253462-177253484
Sequence GCAGCACGTATCCCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942564563_942564567 26 Left 942564563 2:177253462-177253484 CCCTCAAGGGGGATACGTGCTGC No data
Right 942564567 2:177253511-177253533 CATGCCCTGAAAGATTCCTAGGG No data
942564563_942564566 25 Left 942564563 2:177253462-177253484 CCCTCAAGGGGGATACGTGCTGC No data
Right 942564566 2:177253510-177253532 TCATGCCCTGAAAGATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942564563 Original CRISPR GCAGCACGTATCCCCCTTGA GGG (reversed) Intronic
No off target data available for this crispr