ID: 942565828

View in Genome Browser
Species Human (GRCh38)
Location 2:177264370-177264392
Sequence CGCCGCGCTTGCGCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942565828_942565844 28 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565844 2:177264421-177264443 TGGCCAGACGTGGGGGAAGCCGG 0: 1
1: 0
2: 2
3: 23
4: 252
942565828_942565833 -4 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565833 2:177264389-177264411 GGCGGCTCTACCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 66
942565828_942565834 2 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565834 2:177264395-177264417 TCTACCCAGCGCCGCGGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 60
942565828_942565837 8 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565837 2:177264401-177264423 CAGCGCCGCGGTCCTGGCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 149
942565828_942565840 19 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565840 2:177264412-177264434 TCCTGGCTCTGGCCAGACGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
942565828_942565839 18 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565839 2:177264411-177264433 GTCCTGGCTCTGGCCAGACGTGG 0: 1
1: 0
2: 0
3: 17
4: 211
942565828_942565843 21 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565843 2:177264414-177264436 CTGGCTCTGGCCAGACGTGGGGG 0: 1
1: 1
2: 8
3: 116
4: 884
942565828_942565842 20 Left 942565828 2:177264370-177264392 CCTGCCCCGGCGCAAGCGCGGCG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 942565842 2:177264413-177264435 CCTGGCTCTGGCCAGACGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942565828 Original CRISPR CGCCGCGCTTGCGCCGGGGC AGG (reversed) Intronic