ID: 942577137

View in Genome Browser
Species Human (GRCh38)
Location 2:177375590-177375612
Sequence GACAGTGCCCTGATTATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942577132_942577137 -5 Left 942577132 2:177375572-177375594 CCTTGTCTAGGTATTAGAGACAG No data
Right 942577137 2:177375590-177375612 GACAGTGCCCTGATTATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942577137 Original CRISPR GACAGTGCCCTGATTATGGG GGG Intronic
No off target data available for this crispr