ID: 942577291

View in Genome Browser
Species Human (GRCh38)
Location 2:177377653-177377675
Sequence TGGTAGGCTTCAATCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942577291_942577298 29 Left 942577291 2:177377653-177377675 CCATGTCAGATTGAAGCCTACCA No data
Right 942577298 2:177377705-177377727 TTTGCACACATAACCCCATCTGG No data
942577291_942577299 30 Left 942577291 2:177377653-177377675 CCATGTCAGATTGAAGCCTACCA No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data
942577291_942577297 -2 Left 942577291 2:177377653-177377675 CCATGTCAGATTGAAGCCTACCA No data
Right 942577297 2:177377674-177377696 CAGGAGTGGGACTAGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942577291 Original CRISPR TGGTAGGCTTCAATCTGACA TGG (reversed) Intronic
No off target data available for this crispr