ID: 942577295

View in Genome Browser
Species Human (GRCh38)
Location 2:177377669-177377691
Sequence CTTCTAGTCCCACTCCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942577295_942577301 22 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577301 2:177377714-177377736 ATAACCCCATCTGGGAATGGTGG No data
942577295_942577298 13 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577298 2:177377705-177377727 TTTGCACACATAACCCCATCTGG No data
942577295_942577303 24 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577303 2:177377716-177377738 AACCCCATCTGGGAATGGTGGGG No data
942577295_942577302 23 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577302 2:177377715-177377737 TAACCCCATCTGGGAATGGTGGG No data
942577295_942577299 14 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data
942577295_942577300 19 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577300 2:177377711-177377733 CACATAACCCCATCTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942577295 Original CRISPR CTTCTAGTCCCACTCCTGGT AGG (reversed) Intronic
No off target data available for this crispr