ID: 942577296

View in Genome Browser
Species Human (GRCh38)
Location 2:177377673-177377695
Sequence CTAGCTTCTAGTCCCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942577296_942577298 9 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577298 2:177377705-177377727 TTTGCACACATAACCCCATCTGG No data
942577296_942577302 19 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577302 2:177377715-177377737 TAACCCCATCTGGGAATGGTGGG No data
942577296_942577303 20 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577303 2:177377716-177377738 AACCCCATCTGGGAATGGTGGGG No data
942577296_942577299 10 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data
942577296_942577300 15 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577300 2:177377711-177377733 CACATAACCCCATCTGGGAATGG No data
942577296_942577301 18 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577301 2:177377714-177377736 ATAACCCCATCTGGGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942577296 Original CRISPR CTAGCTTCTAGTCCCACTCC TGG (reversed) Intronic
No off target data available for this crispr