ID: 942577299

View in Genome Browser
Species Human (GRCh38)
Location 2:177377706-177377728
Sequence TTGCACACATAACCCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942577296_942577299 10 Left 942577296 2:177377673-177377695 CCAGGAGTGGGACTAGAAGCTAG No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data
942577295_942577299 14 Left 942577295 2:177377669-177377691 CCTACCAGGAGTGGGACTAGAAG No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data
942577291_942577299 30 Left 942577291 2:177377653-177377675 CCATGTCAGATTGAAGCCTACCA No data
Right 942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942577299 Original CRISPR TTGCACACATAACCCCATCT GGG Intronic
No off target data available for this crispr