ID: 942580696

View in Genome Browser
Species Human (GRCh38)
Location 2:177413017-177413039
Sequence CGGCAAACAACAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942580688_942580696 29 Left 942580688 2:177412965-177412987 CCTGCTGGATCTGGAGGGGTGGA 0: 15
1: 48
2: 81
3: 158
4: 318
Right 942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG No data
942580686_942580696 30 Left 942580686 2:177412964-177412986 CCCTGCTGGATCTGGAGGGGTGG 0: 16
1: 50
2: 105
3: 152
4: 348
Right 942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942580696 Original CRISPR CGGCAAACAACAGTGGTGGA TGG Intronic
No off target data available for this crispr