ID: 942581465 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:177423455-177423477 |
| Sequence | CTGTATGGTTATAGAAGGCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942581465_942581469 | 22 | Left | 942581465 | 2:177423455-177423477 | CCTCGCCTTCTATAACCATACAG | No data | ||
| Right | 942581469 | 2:177423500-177423522 | AGAAAGAAATATAACAGAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942581465 | Original CRISPR | CTGTATGGTTATAGAAGGCG AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||