ID: 942581465

View in Genome Browser
Species Human (GRCh38)
Location 2:177423455-177423477
Sequence CTGTATGGTTATAGAAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942581465_942581469 22 Left 942581465 2:177423455-177423477 CCTCGCCTTCTATAACCATACAG No data
Right 942581469 2:177423500-177423522 AGAAAGAAATATAACAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942581465 Original CRISPR CTGTATGGTTATAGAAGGCG AGG (reversed) Intronic
No off target data available for this crispr