ID: 942584927

View in Genome Browser
Species Human (GRCh38)
Location 2:177465628-177465650
Sequence CCTTGTAGGGAGCTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942584927_942584932 -7 Left 942584927 2:177465628-177465650 CCAGGCATCAGCTCCCTACAAGG No data
Right 942584932 2:177465644-177465666 TACAAGGCTGCTGCTGGACCAGG No data
942584927_942584937 28 Left 942584927 2:177465628-177465650 CCAGGCATCAGCTCCCTACAAGG No data
Right 942584937 2:177465679-177465701 AGCTTCCATTGGTGGCACCAGGG No data
942584927_942584934 17 Left 942584927 2:177465628-177465650 CCAGGCATCAGCTCCCTACAAGG No data
Right 942584934 2:177465668-177465690 ATACTGCAAGCAGCTTCCATTGG No data
942584927_942584935 20 Left 942584927 2:177465628-177465650 CCAGGCATCAGCTCCCTACAAGG No data
Right 942584935 2:177465671-177465693 CTGCAAGCAGCTTCCATTGGTGG No data
942584927_942584936 27 Left 942584927 2:177465628-177465650 CCAGGCATCAGCTCCCTACAAGG No data
Right 942584936 2:177465678-177465700 CAGCTTCCATTGGTGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942584927 Original CRISPR CCTTGTAGGGAGCTGATGCC TGG (reversed) Intronic
No off target data available for this crispr