ID: 942586025

View in Genome Browser
Species Human (GRCh38)
Location 2:177479038-177479060
Sequence TTCTCTCTGGGGAGAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942586025_942586036 10 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586036 2:177479071-177479093 ACGGCTCAGGAGTTAGGGGTGGG No data
942586025_942586030 -3 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586030 2:177479058-177479080 GAATCTCTGAACCACGGCTCAGG No data
942586025_942586033 6 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586033 2:177479067-177479089 AACCACGGCTCAGGAGTTAGGGG No data
942586025_942586037 11 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586037 2:177479072-177479094 CGGCTCAGGAGTTAGGGGTGGGG No data
942586025_942586035 9 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586035 2:177479070-177479092 CACGGCTCAGGAGTTAGGGGTGG No data
942586025_942586038 18 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586038 2:177479079-177479101 GGAGTTAGGGGTGGGGACAATGG No data
942586025_942586032 5 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586032 2:177479066-177479088 GAACCACGGCTCAGGAGTTAGGG No data
942586025_942586029 -9 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586029 2:177479052-177479074 CAGAGAGAATCTCTGAACCACGG No data
942586025_942586031 4 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942586025 Original CRISPR TTCTCTCTGGGGAGAGAAAC AGG (reversed) Intronic
No off target data available for this crispr