ID: 942586027

View in Genome Browser
Species Human (GRCh38)
Location 2:177479050-177479072
Sequence GTGGTTCAGAGATTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942586027_942586031 -8 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data
942586027_942586035 -3 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586035 2:177479070-177479092 CACGGCTCAGGAGTTAGGGGTGG No data
942586027_942586038 6 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586038 2:177479079-177479101 GGAGTTAGGGGTGGGGACAATGG No data
942586027_942586037 -1 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586037 2:177479072-177479094 CGGCTCAGGAGTTAGGGGTGGGG No data
942586027_942586036 -2 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586036 2:177479071-177479093 ACGGCTCAGGAGTTAGGGGTGGG No data
942586027_942586033 -6 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586033 2:177479067-177479089 AACCACGGCTCAGGAGTTAGGGG No data
942586027_942586032 -7 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586032 2:177479066-177479088 GAACCACGGCTCAGGAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942586027 Original CRISPR GTGGTTCAGAGATTCTCTCT GGG (reversed) Intronic
No off target data available for this crispr