ID: 942586031

View in Genome Browser
Species Human (GRCh38)
Location 2:177479065-177479087
Sequence TGAACCACGGCTCAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942586025_942586031 4 Left 942586025 2:177479038-177479060 CCTGTTTCTCTCCCCAGAGAGAA No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data
942586026_942586031 -7 Left 942586026 2:177479049-177479071 CCCCAGAGAGAATCTCTGAACCA No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data
942586028_942586031 -9 Left 942586028 2:177479051-177479073 CCAGAGAGAATCTCTGAACCACG No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data
942586027_942586031 -8 Left 942586027 2:177479050-177479072 CCCAGAGAGAATCTCTGAACCAC No data
Right 942586031 2:177479065-177479087 TGAACCACGGCTCAGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942586031 Original CRISPR TGAACCACGGCTCAGGAGTT AGG Intronic
No off target data available for this crispr