ID: 942590352

View in Genome Browser
Species Human (GRCh38)
Location 2:177538160-177538182
Sequence CTGTTTCCAAAGATGTTATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942590352 Original CRISPR CTGTTTCCAAAGATGTTATT GGG (reversed) Exonic
900013748 1:135742-135764 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
900043818 1:491725-491747 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
900065255 1:726728-726750 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
902500587 1:16908417-16908439 CTGTTTCTTCAGATGTTTTTTGG - Intronic
902826859 1:18980634-18980656 TTATTTCTAAAAATGTTATTGGG - Intergenic
905599744 1:39239378-39239400 CTGTTTCCCAAAAGGTTATCAGG - Intronic
906011626 1:42532602-42532624 CTATTTCTAACGCTGTTATTGGG - Intronic
906999731 1:50838652-50838674 CTGCTCCCACAGATGTTACTGGG + Intronic
909006563 1:70282984-70283006 CTGTTTAGAAAGAATTTATTTGG - Intronic
911374676 1:97037438-97037460 CTTTTTCAAAAGATGGTTTTGGG - Intergenic
915487201 1:156230030-156230052 CTGTTTCCAAAAACATTGTTTGG + Intronic
917337250 1:173938142-173938164 CTTTTCCCAGAGCTGTTATTTGG - Exonic
917701348 1:177584829-177584851 CAGTTTCCAAATAAGTTATTTGG - Intergenic
918644227 1:186884477-186884499 GTGTTTCCTAAGTTGTTCTTAGG - Intronic
918749818 1:188258552-188258574 CTGTTGCCAAAGAGTCTATTTGG + Intergenic
919410176 1:197232956-197232978 CTGGTTCCAAAGATATACTTCGG + Intergenic
920525751 1:206664647-206664669 CTGTTTCCATATCTGTAATTTGG + Intronic
920739637 1:208568336-208568358 CTGCTACCAAAGATTTTATGTGG + Intergenic
921427985 1:215027039-215027061 CTTTTTCCAAGTATGTTACTAGG + Intronic
922100140 1:222472673-222472695 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
922226153 1:223647560-223647582 CTTTTTCCAAAGAGGGTTTTAGG - Intronic
922734588 1:227972370-227972392 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
922734873 1:227973512-227973534 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
924343343 1:243054338-243054360 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
1063823069 10:9860005-9860027 ATTTTTCCAAGGATGTTAATTGG - Intergenic
1063926454 10:10982379-10982401 CGGTTTACAAATATATTATTAGG - Intergenic
1066279285 10:33899293-33899315 TTGTTTCCAAAAATGTGATGAGG - Intergenic
1066733134 10:38451191-38451213 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1067261458 10:44696656-44696678 CTGTCTCCAAAAATGTAGTTAGG - Intergenic
1071962179 10:90817617-90817639 CTTTTTCCAAAGAGGTTCTCAGG - Intronic
1072370823 10:94765061-94765083 CTGTTGCCAAAGAGTCTATTTGG + Intronic
1073357157 10:102865883-102865905 CAGTTTTCTAAGATTTTATTCGG - Intronic
1073865039 10:107792661-107792683 ATATTACCAAAGCTGTTATTTGG - Intergenic
1074012100 10:109492591-109492613 CTGTGTCCAGAGTTTTTATTAGG - Intergenic
1074482013 10:113832443-113832465 CTGTTTCTAAATTTATTATTTGG - Intergenic
1074741713 10:116491507-116491529 CTGTTGCCAATGATGTAAATAGG - Intergenic
1074741862 10:116493104-116493126 CTATTTCCAAATACGTTGTTTGG + Intergenic
1074810178 10:117096753-117096775 TTGTGTACAAAGATGTTAATTGG + Intronic
1075268062 10:121022749-121022771 TTGTTTCCAATGTTGCTATTTGG + Intergenic
1076120047 10:127928728-127928750 GTGCTTTCCAAGATGTTATTTGG - Intronic
1076970092 11:127956-127978 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
1079920115 11:26422931-26422953 GTGTTTCCAAAGCTATTATAAGG - Intronic
1080107268 11:28524109-28524131 CTTTTTACCAAGATGTTACTAGG + Intergenic
1081196745 11:40170414-40170436 CTTTCACCAAAGATGTAATTTGG - Intronic
1081513945 11:43806136-43806158 CAGTTTCCAGAGTTTTTATTGGG + Intronic
1082276622 11:50229326-50229348 CTTTTTACAATGATGTCATTTGG - Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085345114 11:75763614-75763636 CTGTTTGCAAAGATGTAAGCAGG - Intronic
1086502212 11:87465106-87465128 CTTTGACCAAAGATGTTATCTGG - Intergenic
1088123041 11:106392186-106392208 CTGTTTCCACAGGAGTTATGAGG - Intergenic
1088610084 11:111568415-111568437 CTGTTTTAAAATATGCTATTAGG + Intergenic
1088785960 11:113182059-113182081 CTGGTTGGAATGATGTTATTTGG + Intronic
1088903476 11:114136323-114136345 CTGTTTCCACAGTTGCTTTTGGG - Intronic
1089093667 11:115899961-115899983 CTGTTTTCACAGATGTTCCTGGG + Intergenic
1089956761 11:122578438-122578460 CAGTGTCCAGAGATTTTATTGGG + Intergenic
1091452200 12:579785-579807 CTTTTTCCAAAGAGGATTTTGGG - Intronic
1092546668 12:9458019-9458041 CTTTTTCCAAAGAGGGTCTTGGG + Intergenic
1093174513 12:15897501-15897523 CTGTTTACAAAGATAATATGTGG + Intronic
1094243592 12:28259642-28259664 CTGATTCTAAAGATGATATCAGG + Intronic
1094402973 12:30082737-30082759 CTGCTTCCTAGGATGTTGTTAGG - Intergenic
1094506269 12:31064053-31064075 CTTTTTCCAAAGAGGGTCTTGGG - Intergenic
1094768877 12:33630150-33630172 CTGCTTTCAAATATGTTTTTTGG - Intergenic
1095717316 12:45360575-45360597 TTGTTTCAAAGGATGCTATTAGG - Intronic
1099576593 12:84391056-84391078 CTGCTGCCAAAGAGGCTATTTGG + Intergenic
1099905660 12:88766598-88766620 TTTTTTCCAAAGATGTTTTCAGG - Intergenic
1100359474 12:93862794-93862816 ATCTTTCCAAAGATGTTAATAGG - Intronic
1101915915 12:108895986-108896008 CTTTTTCCAAAGAGGTTCTCAGG + Intronic
1103492193 12:121330361-121330383 GAATTTCCACAGATGTTATTAGG + Intronic
1104004132 12:124880276-124880298 CTGGTTCCAAAAATATTCTTTGG + Intronic
1104257024 12:127147750-127147772 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1104382669 12:128321407-128321429 GTCTTTTCAAAAATGTTATTTGG - Intronic
1105359840 13:19699738-19699760 CTGTGTTCATAGATGTTTTTAGG - Intronic
1105737757 13:23288851-23288873 CTGTTTTTAAAGATAATATTGGG - Intronic
1106568064 13:30904305-30904327 CTGTTTCAAAACATCTTCTTTGG + Intergenic
1106594045 13:31122044-31122066 CTATTCCCAAAGATGTTATTAGG - Intergenic
1106707319 13:32295212-32295234 CTGCTTCCAAAGATGTCATTGGG - Exonic
1107389756 13:39951637-39951659 CTGTTACCAGAGCTGTTGTTTGG + Intergenic
1109091998 13:58059453-58059475 CTGTTTTCAAATCTGTTCTTAGG - Intergenic
1109131558 13:58592856-58592878 CTGTTTTCAAGAATTTTATTTGG + Intergenic
1109194832 13:59366910-59366932 CTTTTTCCAAGGATCTTTTTTGG - Intergenic
1110346525 13:74454193-74454215 CTATTTCCATAGATATCATTTGG - Intergenic
1111215896 13:85140541-85140563 CTTTTTCCAAAGAGGTTTTTGGG + Intergenic
1112551728 13:100427819-100427841 CTCTTTCCAAAAATGTAATGTGG + Intronic
1112586742 13:100725264-100725286 CTATTTCCAAAGATGATTTGAGG + Intergenic
1112618278 13:101027657-101027679 GTTTTTCCAAAGAGGTTTTTGGG + Intergenic
1113584388 13:111454596-111454618 GTTTTTCAAAAGATGTTTTTTGG + Intergenic
1114746164 14:25149740-25149762 TTGTATCTAAAGATTTTATTTGG - Intergenic
1114793913 14:25690402-25690424 CTGTGTCAAAAGATGGTGTTAGG + Intergenic
1115625823 14:35191008-35191030 CCATTTCCCAACATGTTATTTGG + Intronic
1116127773 14:40810729-40810751 CTGTTTTAAAAGATTTTATGTGG + Intergenic
1116732270 14:48638975-48638997 TTGTTTCTAATGAGGTTATTTGG - Intergenic
1118507028 14:66424742-66424764 CTTTTGCCAAAGATGTTAAAAGG - Intergenic
1120698150 14:87667124-87667146 CTATTTTCAAAGATATTTTTCGG - Intergenic
1120879959 14:89407842-89407864 CTGTTTCTGAAGTTGTTTTTCGG - Intronic
1124070901 15:26392433-26392455 CTTTTTCAAAACATATTATTTGG + Intergenic
1124505776 15:30271952-30271974 TTGTTTCCAAATGTTTTATTTGG - Intergenic
1124737777 15:32266680-32266702 TTGTTTCCAAATGTTTTATTTGG + Intergenic
1125152607 15:36550236-36550258 TGGTTTCAAAAGAAGTTATTGGG - Intergenic
1126840494 15:52713156-52713178 CTATTTCCAAACATGTTTTAAGG - Intergenic
1127897522 15:63315515-63315537 CTTTTTCCAAAGAGGGTTTTAGG + Intergenic
1128882583 15:71257161-71257183 CTGATTCCAAAGATAATAGTAGG + Intronic
1129044829 15:72725553-72725575 CTGTTTTCAGAGATATTATTAGG + Intronic
1129127548 15:73457088-73457110 CTGTTTCCAAATAACTTATCTGG - Intronic
1129953280 15:79610775-79610797 CAGTTTCAGAAGATTTTATTTGG + Intergenic
1130569784 15:85031652-85031674 CTGTTTCCAAATCTATAATTAGG + Intronic
1133531564 16:6659856-6659878 CAGTTTCCAAAGACCTGATTCGG + Intronic
1135257762 16:20954866-20954888 ATGTGGCAAAAGATGTTATTTGG - Exonic
1136690066 16:32022522-32022544 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1136790655 16:32966083-32966105 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1136879160 16:33887849-33887871 CTGTCTCCAAAGAGGTCTTTAGG - Intergenic
1137240523 16:46651928-46651950 GTTTTTCCAAAGATGTTTTCAGG - Intergenic
1138139711 16:54557718-54557740 CTGTTTCCAAAGCTGAAATGAGG + Intergenic
1138256249 16:55565049-55565071 ATTTTTCCAAAGATCTTCTTTGG + Intronic
1138773603 16:59693959-59693981 CTATTTCCAAAGAGGTTTTCAGG + Intergenic
1139129547 16:64124651-64124673 CTGTTTCTAATGATATTTTTAGG + Intergenic
1142450585 16:90171176-90171198 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1203092856 16_KI270728v1_random:1227541-1227563 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1142456977 17:62515-62537 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
1143236041 17:5401595-5401617 CTGTTTTCTAAGATGTTTTATGG - Intronic
1146615441 17:34353509-34353531 CTATTTACAAAGATGTAAGTGGG + Intergenic
1147270960 17:39270745-39270767 TTGTTTCCATAGGTTTTATTAGG - Intronic
1149005947 17:51805585-51805607 CTGTTTTTAAAAATGTTCTTGGG - Intronic
1149030890 17:52080975-52080997 CTGTTTTCCATGAAGTTATTAGG + Intronic
1149143736 17:53465063-53465085 CAGTTTCAAAATATGGTATTAGG + Intergenic
1149187636 17:54017987-54018009 GTGTTTTCAAATATGTTAATTGG + Intergenic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1153021459 18:633315-633337 CTGATTTCAAAGATGTTACCTGG + Exonic
1156597830 18:38567723-38567745 CTGTTTCCAAAAATATGTTTTGG - Intergenic
1157140414 18:45100151-45100173 CTGTTTACAAGGTTTTTATTAGG - Intergenic
1157779804 18:50428195-50428217 CTGTTTCCAAAGAGGGTTTCGGG + Intergenic
1158675592 18:59515035-59515057 CTATCTCCAAAGATGATATAAGG + Intronic
1160505216 18:79423047-79423069 CTGTGTCCAAAGCTGTTGTGAGG + Intronic
1160646890 19:197874-197896 CTGAGTCCAAAGACGTTGTTGGG + Intergenic
1164074052 19:21796895-21796917 CTATTTCCACAAATATTATTTGG + Intergenic
1165139844 19:33692169-33692191 CTGTTTCCAAAGATTTGATTTGG - Intronic
1165554958 19:36622570-36622592 CAGTGTCCAAAGTTTTTATTGGG + Intronic
1167917151 19:52750670-52750692 CTGTTTACAAATAGGTTTTTGGG + Intergenic
1168561583 19:57388992-57389014 GTTTTTCCAAAGAGGTTCTTAGG - Intronic
925045479 2:770140-770162 CTCATGCAAAAGATGTTATTGGG - Intergenic
925055415 2:853463-853485 CTCTTTCCAAAGACGATGTTGGG - Intergenic
928071575 2:28222673-28222695 TGGTTTCCAAAAAAGTTATTAGG + Intronic
928251180 2:29682115-29682137 CTGTTTCCAGAGTTGTTGATGGG + Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
929407684 2:41661159-41661181 CTGTTTCCAGACATTTAATTAGG - Intergenic
931027267 2:58125032-58125054 CTGTTTCTAAAAATTCTATTAGG - Intronic
931527842 2:63177269-63177291 ATATTTCCAAAGATGCCATTGGG + Intronic
931607374 2:64065749-64065771 CTCTTTCTTAAGATGTCATTCGG - Intergenic
931956313 2:67429600-67429622 CTGTTTTCTAATATGTTATTCGG + Intergenic
932918922 2:75887531-75887553 CTGTTGTCAAAGAAGTCATTTGG - Intergenic
933126546 2:78615305-78615327 CTGTGTCCAGAGATGCTCTTTGG + Intergenic
933209546 2:79551237-79551259 CTTTTTCCAAAGAGGTTTTGAGG + Intronic
935712999 2:105915930-105915952 CTTTTTCCAAAGATGATTTTGGG + Intergenic
936122487 2:109758885-109758907 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
936222206 2:110612587-110612609 CTTTTTCCAAAGAGGGTTTTGGG - Intergenic
936668686 2:114630529-114630551 TTATTACGAAAGATGTTATTAGG + Intronic
938112830 2:128580609-128580631 CTGTCTCCAATGGCGTTATTCGG - Intergenic
938562161 2:132482662-132482684 GTGTTTCCAAAGATTTTGTGAGG - Intronic
940025516 2:149202979-149203001 CTGTATCCAAAACTGCTATTTGG - Intronic
940439128 2:153693588-153693610 CTTTTTCCAAAGAAGGTTTTGGG + Intergenic
941133679 2:161686124-161686146 CTTTTTCCAAATTTGTCATTTGG - Intronic
941282209 2:163566899-163566921 CTATTTTTAAAAATGTTATTCGG + Intergenic
941504584 2:166326410-166326432 CTTCCTCCAAAGATGTTATCAGG - Intronic
942380220 2:175383083-175383105 TTTTTTCCAAAGTTGTTATTTGG - Intergenic
942415662 2:175756674-175756696 CTGTTTCCAAAGATATTCCTGGG + Intergenic
942489804 2:176477730-176477752 TTGTTTGCAAACATGTTATTTGG - Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
943972643 2:194430393-194430415 CTTTTTCAAAATCTGTTATTTGG + Intergenic
944723816 2:202449593-202449615 CAGTGTCCAAAGTTTTTATTGGG - Intronic
945799048 2:214402528-214402550 CTGTATTCAAAAATATTATTTGG + Intronic
946206095 2:218109798-218109820 CTGTTGCCAAAGAGTCTATTTGG + Intergenic
946727737 2:222677908-222677930 GAGTTTCCAATGATTTTATTTGG - Intronic
947104773 2:226657823-226657845 CTGTTGCCAACCATGATATTGGG + Intergenic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
948183973 2:236004577-236004599 CTGTCTCCATATATTTTATTTGG - Intronic
948443603 2:238014476-238014498 CCACTTTCAAAGATGTTATTTGG - Intronic
1169234262 20:3916916-3916938 ATGTTTCCAAAGCTGTGATGGGG - Exonic
1171195523 20:23194674-23194696 TTGTCTTCAATGATGTTATTTGG - Intergenic
1172711165 20:36924750-36924772 CTGTTTCCACACTTGTTACTTGG - Intronic
1172817842 20:37703438-37703460 CTTTTGCCAAAGATTTTCTTGGG + Intronic
1173717215 20:45218875-45218897 CTGTTTCTCAAGCTCTTATTGGG + Intergenic
1176950384 21:15038362-15038384 CTCTTTCCAAAGAGGAAATTTGG + Intronic
1177369990 21:20189919-20189941 CTTTTTCCAAACTTGTCATTTGG + Intergenic
1178721651 21:35016059-35016081 CGTTTTCCAAAGCTGTTATTAGG - Intronic
1182313919 22:29430184-29430206 CAGTTTTCAAAGATGATTTTTGG + Intergenic
949276291 3:2286533-2286555 CTGTTTCTAAATATGTTAAGTGG + Intronic
950314237 3:11986470-11986492 CAGTGTGCAAAGATGCTATTAGG - Intergenic
951385812 3:22041062-22041084 GGGTTTCAAAAGATGTCATTAGG + Intronic
951422345 3:22502249-22502271 ACATTTCCAAAGCTGTTATTTGG + Intergenic
951724440 3:25741409-25741431 CTGTTTCAATAAATGATATTAGG + Intronic
953217485 3:40933775-40933797 CTGTTTCAAAACTTGTTATGTGG - Intergenic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
955351825 3:58199290-58199312 CTGTTTCTATAGAAGTTAGTGGG - Intronic
955688276 3:61565303-61565325 GTGTTACCAAACATGATATTAGG + Intronic
957408565 3:79805908-79805930 CAGTTACCATAGATGTTATCAGG - Intergenic
957513445 3:81220270-81220292 CTGTTTACTAAGGTTTTATTAGG + Intergenic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
958067448 3:88561863-88561885 TTGTTTCCAAAAAAGTTATCAGG + Intergenic
958903341 3:99914163-99914185 CTGTTGCCAAATATGTCATGTGG + Intronic
959243863 3:103837388-103837410 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961577507 3:127849867-127849889 CTGTTTCCAAAGCAGATGTTTGG - Intergenic
962311042 3:134327146-134327168 CTGTTTGCAAAGCAGATATTTGG - Intergenic
963352258 3:144166452-144166474 CTATTTCCATAAATGTCATTGGG - Intergenic
964972501 3:162579048-162579070 CTGTTGCCAAAGAGTCTATTTGG - Intergenic
965018047 3:163186338-163186360 ATGTTTCCAATGGTGTTGTTCGG + Intergenic
965233153 3:166079295-166079317 CTGTGTCCAAAGTATTTATTTGG - Intergenic
968370791 3:198221648-198221670 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
968425523 4:520483-520505 CTCTTTCCAAAGAGGTTGTAAGG + Intronic
970733153 4:19132872-19132894 ATGTTTAGAAACATGTTATTTGG - Intergenic
970963315 4:21898508-21898530 CTGTGTCTAGAAATGTTATTGGG - Intronic
971193595 4:24450742-24450764 CTGTTTTCAAAGATGTCTGTAGG - Intergenic
973713610 4:53653417-53653439 CTCTTTCCAGAGATGTGAGTCGG + Intronic
973766901 4:54170978-54171000 CTGTTTTCCAAGATGTTGCTTGG + Intronic
973882481 4:55287947-55287969 CTGTTTGGAAAGACATTATTTGG - Intergenic
974081591 4:57219374-57219396 CTGTGTCCAGAGCTTTTATTGGG + Intergenic
974129176 4:57731531-57731553 CTGTGTGCAAAGAGGTTGTTTGG - Intergenic
974248828 4:59359391-59359413 GTGTTTACAAAGAGATTATTTGG + Intergenic
974695148 4:65358088-65358110 CTGTTTCAATAGATCTGATTGGG - Intronic
974923934 4:68274873-68274895 TTGTTTCCAAAGAAGTTCTTGGG - Intergenic
975143917 4:70946758-70946780 CTTTTTCCAAAGAGGGTTTTGGG + Intronic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
976338305 4:83916550-83916572 CTGTTTCCATAGATTTTCTAGGG - Intergenic
976879473 4:89901545-89901567 TTGTTTTCAAAGTTATTATTAGG + Intronic
976916863 4:90386831-90386853 GTCTTTCTAAAGATGTCATTTGG - Intronic
976986946 4:91313381-91313403 TTCTTTCTAAAGATCTTATTTGG + Intronic
977256734 4:94749266-94749288 TTGTTTCAAAAGATCTTTTTTGG + Intergenic
978704941 4:111696848-111696870 CTTTTCCCAAATATTTTATTTGG - Intergenic
979000584 4:115213162-115213184 CTATTTTCAAATATTTTATTTGG + Intergenic
979259468 4:118634139-118634161 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
980272182 4:130598921-130598943 CTGATTCCAGAGACTTTATTAGG - Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
981641433 4:146947875-146947897 TTCTTTCCTAAGATGTTACTTGG - Intergenic
981746735 4:148059584-148059606 TTTTTCCCAAAGATGTTCTTTGG + Intronic
981870978 4:149486249-149486271 GTGTGTCCAGAGATGTTATTTGG + Intergenic
982081221 4:151792348-151792370 TTGTTCGCAAAGATGTGATTTGG - Intergenic
982512644 4:156302629-156302651 TAATTTCCAAATATGTTATTAGG + Intergenic
982672758 4:158341653-158341675 TTGTTTCTGAAGCTGTTATTTGG - Intronic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
985237524 4:187892338-187892360 CTGTTTTCCAAGTTGTAATTAGG + Intergenic
985607374 5:865257-865279 CGGTTTCCACAGATGTCCTTGGG - Intronic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
988922758 5:35960153-35960175 CTGTTGCAAAAGAAGTTATTGGG - Intronic
989387824 5:40870872-40870894 TTCTTTCCAAAGATGTTTTCGGG + Intergenic
989957775 5:50376090-50376112 CTGCTGCCAAAGAGTTTATTTGG - Intergenic
990018118 5:51091239-51091261 CTGATTCCTAAAATATTATTGGG - Intergenic
990744450 5:58944701-58944723 TTTTTTCCAAAGAGGTTCTTAGG + Intergenic
990901988 5:60761462-60761484 CTGTTCCCAGAAATGTTGTTTGG - Intronic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
992256688 5:74928459-74928481 CGTTTTCCAAAGATGATGTTAGG + Intergenic
992489131 5:77223993-77224015 CTGTTTACAAAGGTGTTAGAAGG - Intronic
993168658 5:84387379-84387401 CTTTTCCCCAAGATGTTAATAGG + Intergenic
993933332 5:93970372-93970394 CTGTTTTCTAAGATTTTATTTGG - Intronic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994869641 5:105331272-105331294 TTGTTTCCATAGAAGTGATTTGG + Intergenic
995889642 5:116936556-116936578 TTGTCTCCAAATATGTTAATCGG + Intergenic
996282925 5:121753859-121753881 CTTTCTCCAAAGATGATTTTGGG + Intergenic
996591518 5:125153173-125153195 CTGTTCCCCTAGAAGTTATTAGG + Intergenic
997967132 5:138366869-138366891 CTGTTGACAAAGATGTTGTTTGG - Intronic
998997941 5:147886964-147886986 CCATTTCCAAAGATGGGATTAGG + Intronic
1000682673 5:164205414-164205436 TTGTTTTCAAAGATGCTACTAGG - Intergenic
1000747579 5:165053957-165053979 CTGTACCCAAATATTTTATTGGG - Intergenic
1001459805 5:171901706-171901728 TTGTTTCAATAGATGTTTTTGGG - Intronic
1001588239 5:172847890-172847912 CCATTTCCAAAGATGTTATAAGG - Intronic
1002730025 5:181327204-181327226 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1003232273 6:4265311-4265333 CAGTTTCCAAAGGTATTAGTGGG + Intergenic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1007083282 6:39124133-39124155 CTGTCACCAAAGAAGATATTTGG + Intergenic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1009342655 6:62576611-62576633 CTTATTTCAAAGATATTATTAGG - Intergenic
1009832109 6:68951219-68951241 GTGTTTCCAGAAATGTTATGGGG - Intronic
1010357476 6:74950989-74951011 CTGTTTGGAAAGATGTTTCTAGG - Intergenic
1010867385 6:80995859-80995881 CTGTTTACAAAGGTAATATTTGG - Intergenic
1011669027 6:89664382-89664404 TTGTTTCAAAAGATTATATTGGG + Intronic
1012020455 6:93911558-93911580 CTGGTTTCAAAAATGTAATTTGG + Intergenic
1012089881 6:94877865-94877887 CTTATTCCAAAGATGATCTTTGG - Intergenic
1013626383 6:111941153-111941175 CTGTTTACAAAGATGTGAGTGGG - Intergenic
1013700850 6:112767670-112767692 CAGTGTCCAAAGTTTTTATTGGG - Intergenic
1013795879 6:113888401-113888423 TTGTTTCCAAAGCTGGTATCTGG + Intergenic
1015066852 6:129040319-129040341 CTTTTTGAAAAGAAGTTATTGGG + Intronic
1015646838 6:135400907-135400929 CTTTCTCCAAAGATGATTTTGGG - Intronic
1016688136 6:146904320-146904342 TTTTTTGCAAAGCTGTTATTTGG + Intergenic
1019768563 7:2869297-2869319 CTGTTGCCAAAGATGTGAAGAGG - Intergenic
1019887258 7:3916083-3916105 CTTTTTCCAAAGAGGGTTTTTGG + Intronic
1020454778 7:8359508-8359530 CAGTGTCCACAGATTTTATTGGG - Intergenic
1020743285 7:12049604-12049626 CAGTTGCCCCAGATGTTATTGGG + Intergenic
1020966905 7:14882006-14882028 CTTATTTCAAATATGTTATTTGG - Intronic
1021071581 7:16248564-16248586 CTATTTCCCAATATTTTATTAGG - Intronic
1021791988 7:24215249-24215271 CAGTTTCCAAGGATGTTAATTGG - Intergenic
1022945312 7:35278258-35278280 TTGGTTACAAAGATGTTTTTTGG + Intergenic
1023187534 7:37547814-37547836 CTTTTTCCAAAGGTGGTTTTGGG + Intergenic
1023400912 7:39792667-39792689 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1024074365 7:45811136-45811158 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1024074698 7:45812494-45812516 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1024075184 7:45814408-45814430 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1024525997 7:50349830-50349852 ATGTTTTAAAACATGTTATTGGG + Intronic
1024648720 7:51388110-51388132 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1024870194 7:53955905-53955927 CTGCTGCCAAAGAGTTTATTTGG + Intergenic
1025053049 7:55744392-55744414 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025129225 7:56367070-56367092 CTGAGTCCAAAGAAGTTGTTGGG + Intergenic
1025129948 7:56369942-56369964 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025130247 7:56371171-56371193 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025130567 7:56372469-56372491 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025130885 7:56373763-56373785 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025131204 7:56375058-56375080 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025176250 7:56803904-56803926 CTGAATCCAAAGAGGTTGTTGGG - Intergenic
1025177645 7:56810108-56810130 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025178244 7:56812579-56812601 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025178676 7:56814321-56814343 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025179114 7:56816111-56816133 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025179569 7:56817997-56818019 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025180019 7:56819835-56819857 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025180490 7:56821817-56821839 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025181364 7:56825406-56825428 CTGAGTCCAAAGAGGTTGTTGGG + Intronic
1025181811 7:56827244-56827266 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025613309 7:63096772-63096794 CTGTTTTCAGAGATGGTCTTTGG + Intergenic
1025690108 7:63749751-63749773 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025690555 7:63751574-63751596 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025691003 7:63753397-63753419 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025691440 7:63755173-63755195 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1025691879 7:63756996-63757018 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025692327 7:63758819-63758841 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025692772 7:63760642-63760664 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1025693188 7:63762321-63762343 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025693633 7:63764144-63764166 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1025694110 7:63766131-63766153 CTGAGTCCAAAGAGGTTGTTGGG - Intergenic
1025695541 7:63772518-63772540 CTGAGTCCAAAGAGGTTGTTGGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1027413809 7:77951897-77951919 CAATTTCCAAAGAAATTATTTGG - Intronic
1028579072 7:92386215-92386237 CACTTTCCAAAGATATTATTTGG + Intronic
1029029530 7:97453307-97453329 CTTTTTCCAAAGAAGTTTTTGGG + Intergenic
1030560426 7:111078138-111078160 CTGTTTTCAGAAATGTTACTTGG - Intronic
1030750967 7:113232315-113232337 CTGTTTCCACATATGTAATATGG - Intergenic
1031516522 7:122706916-122706938 CGGTTTCCAAGGATTTCATTAGG - Intronic
1032051694 7:128654128-128654150 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1034206951 7:149325193-149325215 CTGTTTCAAAATATGTGTTTAGG + Intergenic
1034797446 7:154027291-154027313 CTGTTTCTAAACATTTTTTTTGG + Intronic
1035433949 7:158843841-158843863 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1036174683 8:6525875-6525897 ATATTTGCAAAGATGATATTTGG + Intronic
1039196314 8:35035355-35035377 CTGTTTGCAAAGATGTTGGCAGG - Intergenic
1039575643 8:38621714-38621736 TGGTTCCCAAGGATGTTATTAGG + Intergenic
1039949304 8:42155470-42155492 CTGCTTGCAAAGATGAGATTGGG + Intronic
1042973219 8:74433836-74433858 CAGTATCCAAAGTTTTTATTGGG - Intronic
1043378210 8:79673644-79673666 CTGTTTCCTCAGATGTAAATTGG + Intergenic
1043588358 8:81795930-81795952 ATGTTTACAAAGATGTTTCTCGG - Intergenic
1043852021 8:85226424-85226446 TTGTTATAAAAGATGTTATTGGG - Intronic
1045892676 8:107175461-107175483 TGGTTTCCAAAAGTGTTATTAGG - Intergenic
1046045137 8:108955241-108955263 CTGTTTCCAAAACTCTTATCAGG + Intergenic
1046087519 8:109456798-109456820 CTGCTTTCAAACATGTTCTTTGG - Intronic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1046669988 8:117046383-117046405 ATAATTCCAAACATGTTATTTGG + Intronic
1047181841 8:122595868-122595890 CCTTTTTCAAAGATGTTAGTGGG - Intergenic
1047862641 8:128985144-128985166 CTGTTTACAAAGATGTGAGAAGG - Intergenic
1047921649 8:129640630-129640652 CTATCTCTAAAGATGGTATTAGG + Intergenic
1047977216 8:130142535-130142557 CTGTTTCCACAGATGTTTAATGG - Intronic
1049865914 8:144935504-144935526 CTTTTTAAAAAGATGTTCTTTGG - Intronic
1049877545 8:145035316-145035338 CTGCTGCCAAAGAGTTTATTTGG - Intergenic
1050445209 9:5714658-5714680 ATCTTTCCAAATATGTTGTTGGG + Intronic
1051486815 9:17617603-17617625 CTGTCTCGAAAGATGTTAACAGG - Intronic
1051671009 9:19510693-19510715 CTGTTTTTAAAGATTTTATTAGG + Exonic
1052561679 9:30091411-30091433 CTGTTTCCTAAGATGCTGTATGG + Intergenic
1053117974 9:35522226-35522248 CTGTTTACAAACATTTGATTTGG + Intronic
1054921110 9:70543030-70543052 CTTTTTCCAAAGCTGATCTTTGG - Intronic
1055413872 9:76062309-76062331 ATGTTTCCAAATTTGATATTTGG - Intronic
1055763089 9:79631029-79631051 CTGTTTCCTAAGGGTTTATTGGG - Intronic
1055857433 9:80707151-80707173 CAGTGTCCAGAGATTTTATTGGG + Intergenic
1055967850 9:81882717-81882739 CTGTTTACAAAGATGTGGGTGGG - Intergenic
1055982106 9:82014289-82014311 CTGTGTCCTAAGTTTTTATTGGG - Intergenic
1056799738 9:89682709-89682731 CTGTGTCCCAAGATGTCATGAGG - Intergenic
1058526618 9:105865530-105865552 CTGTTTCCTAAGAGGTGAGTAGG - Intergenic
1058871449 9:109205203-109205225 GCGTTTCCCAAGATGTTATAAGG - Intronic
1059687220 9:116649274-116649296 CTGGCTCCAAAGATTTTATATGG - Intronic
1060319389 9:122541824-122541846 CAGTTTCCACAAATGTTATTTGG + Intergenic
1062122398 9:134840883-134840905 CCGTTCCCAAAGATGGTATTAGG - Intronic
1062754440 9:138279718-138279740 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1203578344 Un_KI270745v1:23878-23900 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1185678263 X:1866436-1866458 CTTTCACCAAACATGTTATTGGG + Intergenic
1186090764 X:6046255-6046277 CTGTTACCAAAGATCTTATTGGG - Intronic
1187896516 X:23985990-23986012 CAGTTTCCAAACATGAAATTTGG - Exonic
1188065558 X:25655464-25655486 CTGATTCACATGATGTTATTTGG + Intergenic
1190014956 X:46818912-46818934 CTGGTTTCAAAATTGTTATTAGG + Intergenic
1191736031 X:64388695-64388717 CTAGTTCCACAGATGTTAATAGG + Intronic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1192430573 X:71108838-71108860 CTGTTTCCTAAGATGTAAGATGG - Intronic
1194939899 X:99997134-99997156 CAGTTTCCAACAATGTTATCTGG + Intergenic
1195124462 X:101792416-101792438 GTGTTTTCAAAAATATTATTTGG + Intergenic
1195593888 X:106665757-106665779 CTGGAGCCAAAAATGTTATTTGG + Intronic
1197524377 X:127544585-127544607 TTGTTTCCAGAGATGCTATCCGG + Intergenic
1197813726 X:130475181-130475203 CTGTTTCCATCGATGTGATAAGG + Intergenic
1197996416 X:132380379-132380401 TTGTTTCCAGAGGTGTCATTTGG - Intronic
1199076441 X:143531348-143531370 TTTATTCCAAAGATGGTATTTGG + Intergenic
1199501296 X:148509505-148509527 ATGTTTCCAAAGCTCTTCTTGGG - Intronic
1201309823 Y:12586870-12586892 CTGTTTCTGAATAGGTTATTTGG + Intergenic
1202380983 Y:24276505-24276527 CTGAGTCCAAAGACGTTGTTGGG - Intergenic
1202489802 Y:25393621-25393643 CTGAGTCCAAAGACGTTGTTGGG + Intergenic