ID: 942591078

View in Genome Browser
Species Human (GRCh38)
Location 2:177547608-177547630
Sequence TTTTCTCCCTGGTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 9, 3: 59, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942591078_942591081 -8 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591081 2:177547623-177547645 GGAGAAAATGAGCCCAGATGAGG 0: 1
1: 1
2: 4
3: 50
4: 433
942591078_942591082 0 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591082 2:177547631-177547653 TGAGCCCAGATGAGGATTACAGG 0: 1
1: 0
2: 1
3: 7
4: 108
942591078_942591087 8 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591087 2:177547639-177547661 GATGAGGATTACAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 27
4: 225
942591078_942591083 1 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591083 2:177547632-177547654 GAGCCCAGATGAGGATTACAGGG 0: 1
1: 0
2: 2
3: 11
4: 125
942591078_942591086 7 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591086 2:177547638-177547660 AGATGAGGATTACAGGGCAGAGG 0: 1
1: 0
2: 2
3: 32
4: 264
942591078_942591088 9 Left 942591078 2:177547608-177547630 CCTCCAGGACACCAGGGAGAAAA 0: 1
1: 0
2: 9
3: 59
4: 305
Right 942591088 2:177547640-177547662 ATGAGGATTACAGGGCAGAGGGG 0: 1
1: 0
2: 1
3: 26
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942591078 Original CRISPR TTTTCTCCCTGGTGTCCTGG AGG (reversed) Intergenic
900396605 1:2455618-2455640 CTTGTTCCCTGGGGTCCTGGGGG + Intronic
900439362 1:2645665-2645687 TCTTCTCCCTGGGGTCCTAGAGG + Intronic
900590217 1:3456106-3456128 GTTTCTCCCCAGTGTCCAGGTGG - Intronic
900689472 1:3971597-3971619 TTTTCTTACTGGTGTCCTGGGGG - Intergenic
900703650 1:4062861-4062883 GATGTTCCCTGGTGTCCTGGGGG + Intergenic
901449349 1:9326526-9326548 TGTTCTCCCTGGTGGACTGGTGG + Intronic
901811179 1:11767429-11767451 TCTTGTCCCTGGGGCCCTGGAGG - Intronic
901956408 1:12788740-12788762 GATTCTCACTGGGGTCCTGGGGG + Intergenic
901971882 1:12914663-12914685 GATTCTCACTGGGGTCCTGGGGG + Intronic
901979787 1:13024795-13024817 GATTCTCACTGGGGTCCTGGGGG + Intronic
902002296 1:13204143-13204165 GATTCTCACTGGGGTCCTGGGGG - Intergenic
902013286 1:13287077-13287099 GATTCTCACTGGGGTCCTGGGGG - Intergenic
902673696 1:17993700-17993722 TTTTCTCTCTTTTCTCCTGGAGG - Intergenic
902771129 1:18646284-18646306 CTTTTTCTCTGGTGGCCTGGTGG + Intronic
902882061 1:19378638-19378660 GTTACTCCATGGTGACCTGGAGG + Exonic
903194067 1:21671995-21672017 TAATCTCCCATGTGTCCTGGGGG + Intergenic
903477164 1:23627524-23627546 ATTGCTCACTGTTGTCCTGGAGG - Exonic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
904062145 1:27720061-27720083 ATTTGGCCCTGGTGTCCTGGCGG + Intergenic
904577979 1:31517718-31517740 TTTTTGCCTTGGTGTACTGGAGG + Intergenic
904604450 1:31691189-31691211 TTGTCTCCCTTGGGGCCTGGTGG + Exonic
906783702 1:48595727-48595749 TTTCCTCCCTGGTGTCTAGGTGG - Intronic
910142239 1:84038503-84038525 TTTTCTCACAGGAGTCCTTGGGG - Intergenic
910232737 1:85003188-85003210 TTATCTCACTGGGGTCCTTGGGG + Intronic
910317970 1:85909960-85909982 TTTTCTCCCTGCGGACCTAGTGG + Exonic
911739985 1:101376685-101376707 TTTTCTCCCTGGTTCTCTGTTGG + Intergenic
911856909 1:102889510-102889532 TTTTCCCCTTGTTCTCCTGGAGG + Exonic
914408221 1:147398709-147398731 TTTTTTCCCTGCCTTCCTGGAGG + Intergenic
915557820 1:156670035-156670057 TTTTCTTCCTGGGGTCCCTGGGG - Exonic
915599212 1:156912252-156912274 TTTTCTCCCCAGTGTCCTGGAGG - Exonic
915900955 1:159846469-159846491 TTTTCCACCTCATGTCCTGGAGG + Intronic
916248558 1:162712511-162712533 TTTACTTCCTGGTTTCCTGGTGG + Intronic
916489372 1:165288058-165288080 TTTTCAGCCTAGTGACCTGGAGG - Intronic
916892676 1:169127738-169127760 TTTTTTCCCTGGTGGTCTAGTGG + Intronic
917285738 1:173419693-173419715 TATTCTCCCTTGTGTCCTCATGG - Intergenic
920042685 1:203113132-203113154 GTTCCTCCCTGGTCTCATGGAGG + Intronic
922755541 1:228094670-228094692 TCCTCTCCCTGGTTCCCTGGGGG + Intronic
923070449 1:230559515-230559537 TTTTCTCCCTCATATGCTGGGGG - Intergenic
924081236 1:240400518-240400540 ATTTCTGCCTGGTGTACTGTGGG + Intronic
924586522 1:245365606-245365628 TTTTCTCCCTAATGTCCTAGAGG + Intronic
924605240 1:245528511-245528533 TTTGCTCCCTGCTGTCCTGGAGG - Intronic
1063727907 10:8659540-8659562 TTTTCTCCATGTTGGCCAGGCGG + Intergenic
1064829847 10:19450731-19450753 TTTTTTCCCTGTGGTTCTGGAGG + Intronic
1065057230 10:21858761-21858783 TTTCCTCCCTGGTGACCTAGTGG - Intronic
1065378579 10:25066611-25066633 ATTTCTTCCTGGGGTCCTGGAGG + Intergenic
1067215456 10:44298864-44298886 ATTCCTGCCTGTTGTCCTGGAGG - Intergenic
1067429654 10:46234621-46234643 TCTTCTCCCTGGTAGCCAGGAGG + Intergenic
1067741404 10:48898368-48898390 TTTTCTGCCAGCTGCCCTGGAGG - Intronic
1068283849 10:54909951-54909973 TCTTCTCCCCGTTTTCCTGGTGG + Intronic
1068452079 10:57203820-57203842 TTTTCCCCCTGCTGTTCTCGTGG + Intergenic
1069250385 10:66259249-66259271 TTTTCTCTCTGTTGTCATGAAGG - Intronic
1069636803 10:69930064-69930086 TTTTCCCCATCGTGTCCTGGAGG - Exonic
1069636905 10:69930466-69930488 TTTTCTCCCTTCACTCCTGGAGG - Exonic
1069695451 10:70382386-70382408 TTTTCCACCGGGTGACCTGGGGG + Intronic
1070355072 10:75631831-75631853 TTTTCGCCATGGTCTTCTGGAGG + Intronic
1070783216 10:79149257-79149279 TTTTGTCCCTGGTGGGCTGTCGG + Intronic
1071076465 10:81759441-81759463 TCTTCTCCATGGTGGCCAGGTGG - Intergenic
1071569415 10:86688481-86688503 TCTGCTCCCTGGTGGCCTAGAGG - Intronic
1071790042 10:88943805-88943827 TTTTCTCCCGGTTGGCCTTGGGG + Exonic
1072090492 10:92122161-92122183 TTTTCTCCCCAGTGTCCTGTAGG - Intronic
1073304369 10:102491517-102491539 TTTACTCCTTGGTCTCCTGATGG + Intronic
1073509170 10:104032685-104032707 TTTTCTCCCTTGTGTCCTCGAGG + Exonic
1073549921 10:104389252-104389274 TTATCTTCTTGGTGTCCTGACGG + Intronic
1074388468 10:113036388-113036410 TTTTCTCCCTGTTTTCATTGGGG + Intronic
1075118943 10:119650921-119650943 TTTTCTCCCTGGCTTCCTTCCGG + Intergenic
1075272991 10:121069208-121069230 GTTTCTGCCTGGTGTCTGGGTGG - Intergenic
1075640808 10:124063032-124063054 TTTGCCTCCTGGTGTCTTGGTGG - Intronic
1076340218 10:129740370-129740392 TGCTCTCCCTGGTTTCCTGGGGG - Intronic
1076357244 10:129862050-129862072 GTTTCTCCCGTGTCTCCTGGCGG - Intronic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1077600329 11:3570156-3570178 TCTGCACCCTGGTGTCCTGAGGG - Intergenic
1079228573 11:18629592-18629614 TTTTCTCCCTGGGTTCCAGTAGG - Intronic
1079980134 11:27142760-27142782 TTTTCTCAGTGGTTTCCAGGAGG - Intergenic
1080585053 11:33674368-33674390 TCTTCTCCCTTGGGTCCTGTTGG - Intergenic
1081285038 11:41257650-41257672 TTTGCCCCCTGGTGACCTGTTGG - Intronic
1084523670 11:69682797-69682819 TTTTCTACCTGCTTCCCTGGTGG + Intergenic
1084631476 11:70354426-70354448 TTATGTCCCTGATGTCCTCGTGG - Exonic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1085566124 11:77515283-77515305 TTTTCTCATTTGTGTCATGGCGG + Intronic
1085893147 11:80604994-80605016 TTTTCCCCCTGCTGTTCTTGTGG - Intergenic
1088264219 11:107974330-107974352 TTTTCTGCCTGGTCTCCCTGGGG + Intergenic
1088662163 11:112058550-112058572 TTTTATCCGTGGTCTCCTTGGGG - Intronic
1092099306 12:5870085-5870107 TGTTGTCCCTGGTGCCATGGTGG - Intronic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1092718015 12:11411620-11411642 TTTTCTTCCTGGTGGGTTGGTGG + Intronic
1092997522 12:13963992-13964014 TCTTCACCCTGGGGTCCTGATGG + Intronic
1093494814 12:19744115-19744137 TTTTCTCAGTGGTGTTTTGGTGG - Intergenic
1094807425 12:34106955-34106977 ATTTCTCCCTTGTGTCATAGTGG - Intergenic
1095952513 12:47789535-47789557 TGATCTGCATGGTGTCCTGGGGG + Exonic
1096756845 12:53806687-53806709 TCTTCTCCCTAATGTCCTTGTGG + Intergenic
1098149405 12:67530766-67530788 TTTTTTCCATGCTGTTCTGGTGG + Intergenic
1098768048 12:74514763-74514785 TTTTGTCCCTGCTGTTCTGTGGG + Intergenic
1099908548 12:88801125-88801147 TTTTCTCTCTGGGGAGCTGGGGG - Intergenic
1100817346 12:98398878-98398900 ATTTCTGCCTTGTGTCGTGGCGG + Intergenic
1101279240 12:103234546-103234568 TTTACTGCCTAGTGTACTGGGGG + Intergenic
1102073322 12:110039950-110039972 TTTTCTTCATAGTGTCCTTGTGG - Intronic
1103266624 12:119636082-119636104 TGTCCTCCCTGGAGTCCAGGGGG + Intronic
1103554324 12:121756910-121756932 TCTTCTCCCTGCTCTCCAGGTGG - Intronic
1104816578 12:131649644-131649666 ATTTCTCCCTAGTGTCTTAGAGG - Intergenic
1105654741 13:22423978-22424000 TTTTCTCCCTGGTTTCTTTTAGG + Intergenic
1105849978 13:24325068-24325090 TTTTATCCCTGGTTTTCTGAGGG - Intergenic
1106329808 13:28729674-28729696 TTTTACCACTGGTGTCCTCGAGG + Intergenic
1106707479 13:32297012-32297034 GTTTCTCCCTGTGTTCCTGGGGG - Exonic
1107064934 13:36202960-36202982 TTTTCAGCCTGGTTTCCTGAGGG + Intronic
1108066117 13:46579016-46579038 GTTTCTCCCTGGTGTGTAGGTGG + Intronic
1108180037 13:47831690-47831712 TTGTCTCCCTGCTGCCATGGTGG - Intergenic
1108679001 13:52763385-52763407 TTTCTTCCCTGGAGACCTGGTGG - Intergenic
1112084990 13:96020657-96020679 CTTTCTCCCTGTACTCCTGGTGG - Intronic
1113969714 13:114179491-114179513 TGCTTTCCCTGGAGTCCTGGAGG + Intergenic
1114726530 14:24943374-24943396 TTTTCTCACAGGAGTCCAGGTGG - Intronic
1114798959 14:25749805-25749827 TTTTTTCCATGTTGTTCTGGTGG + Intergenic
1116045243 14:39734716-39734738 TTTTCTCACAGGGGTCCTTGGGG - Intergenic
1117267833 14:54108806-54108828 CATTCTCCCTGGTGTTTTGGTGG - Intergenic
1117937639 14:60925222-60925244 TATGCTCCCTGGTGTCCAGGGGG + Intronic
1118374392 14:65163986-65164008 TTCTCTCCGTGATGTCCTGATGG + Intergenic
1119749821 14:77069153-77069175 TTGGCTCCATGGTGTTCTGGTGG - Intergenic
1120564550 14:86038615-86038637 TTCTCAGTCTGGTGTCCTGGTGG - Intergenic
1120621319 14:86768187-86768209 TTTTCTCCCTTTTGTTCAGGAGG + Intergenic
1120733017 14:88023727-88023749 ATTTCTCACTGGCTTCCTGGTGG - Intergenic
1120924845 14:89787746-89787768 TGTTCTCTCTGCAGTCCTGGTGG - Intergenic
1122615877 14:103017555-103017577 GTTTCCCCCTCGTGTCCTGTGGG - Intronic
1122967981 14:105140107-105140129 TTTTCTATCTCTTGTCCTGGGGG + Intergenic
1124708359 15:31984126-31984148 TTTGCTCCCTAGTGTGTTGGAGG + Intergenic
1125199636 15:37091343-37091365 TTTTCTACTTGGTGTGCTGGTGG + Intronic
1125349892 15:38755566-38755588 TTTTTTCCCAGGGGTCCTGGAGG + Intergenic
1126420878 15:48470587-48470609 TCAGCTCCCTGGTGTCCCGGGGG - Intronic
1126704490 15:51394918-51394940 TTTTCTCCCTTCTGCCCTGGTGG - Exonic
1126892774 15:53223773-53223795 TTTCTTCACTGCTGTCCTGGGGG + Intergenic
1127331892 15:57947931-57947953 TTTTCTCTCTGCTGTCCTTTAGG + Intergenic
1128055819 15:64699523-64699545 TTTTCTCCCTGGATTTGTGGGGG - Intronic
1129514629 15:76149731-76149753 TTTTTTCTCTGTTGTCATGGAGG - Intronic
1129872431 15:78949159-78949181 GTTTCTCCATGGTGCCCAGGCGG + Intronic
1130160023 15:81389432-81389454 CTCTCTCCCTTGTGTCCTGCAGG - Intergenic
1132971336 16:2690709-2690731 TTTCCTTCCTCGTGTCATGGGGG + Intronic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1136373578 16:29851086-29851108 TTTTCTCCCTGGGACCCAGGTGG - Intergenic
1136509629 16:30728959-30728981 TTTCCTCCAGGGAGTCCTGGGGG - Exonic
1138549683 16:57740605-57740627 TTTTCTCCCTTCTTTCCAGGAGG + Intronic
1138584130 16:57959794-57959816 TTTTCTTCCAGGTTTCCAGGAGG + Intronic
1139202361 16:64991126-64991148 ATTTCTGCCTGGTGCCCTTGGGG + Intronic
1139951296 16:70672424-70672446 TTTTCTCTCTCCTGTCCTGCTGG - Intronic
1140419628 16:74807667-74807689 TGTGCTCCCTGCTGTCTTGGCGG - Intergenic
1141519252 16:84566740-84566762 TTTTCTCCCTGGTGGGCTGGTGG + Exonic
1142310319 16:89308571-89308593 TCTTCTCCCAACTGTCCTGGTGG - Intronic
1142803124 17:2357347-2357369 TTGTCACCCTGGTTTTCTGGTGG - Intronic
1143454153 17:7054939-7054961 TTATTTCCCTGTTGTCCTTGAGG + Intergenic
1143845699 17:9771524-9771546 TTTTCGCCGTGGTGGCCTGTGGG - Exonic
1144180546 17:12747447-12747469 TTTTCTCTCGGTTGTCCTGCTGG - Intronic
1144627903 17:16854389-16854411 TTTTCTCCCTGGTGGGCTGGTGG - Intergenic
1145159492 17:20564970-20564992 TTTTCTCCCTGGTGGGCTGGTGG - Intergenic
1148520122 17:48265752-48265774 TTTTCTCCCTAGTTTCATGGGGG - Intronic
1150301198 17:64048757-64048779 TTTTCTACCTGGTGACATGAGGG - Intronic
1150324494 17:64245792-64245814 TTTGCTCTCTGTTGTGCTGGGGG - Intronic
1151519002 17:74615159-74615181 TTTCCTCACTGCTGGCCTGGGGG - Intronic
1152543768 17:80990583-80990605 TTTTTTCCTTGGTGTCCATGGGG - Intergenic
1154345794 18:13542632-13542654 TCTTCTCCCTGGATTCCTGAGGG - Intronic
1155276275 18:24190435-24190457 TTCCCTCTCTGGTGCCCTGGAGG - Intronic
1155468971 18:26170770-26170792 TGTTCTCTCTGATGTCCAGGAGG - Intronic
1155621366 18:27784370-27784392 TTCTCTTCCTGGGCTCCTGGGGG - Intergenic
1158847175 18:61456831-61456853 TTCTCTTCCTGGTGTGCAGGTGG + Intronic
1159127241 18:64237849-64237871 TCTTGTCCTTGGTGGCCTGGTGG + Intergenic
1159232814 18:65630693-65630715 TTCTCTTGCTGGTGTACTGGGGG + Intergenic
1161071870 19:2266527-2266549 TTCTCTCCCTGCTGTCCGGGAGG + Intronic
1161475603 19:4483192-4483214 TTGTCTCCCTTGTGTCTTCGTGG - Intronic
1162549503 19:11350819-11350841 TTCTCTCCCTGGCGGCCTGTGGG - Exonic
1163413706 19:17172752-17172774 TCTTCTCCCGGAAGTCCTGGTGG - Exonic
1165204769 19:34173645-34173667 TTTTCTTTCTGGTTTCCTGGCGG - Intronic
1167774737 19:51547414-51547436 TACCCTCCCAGGTGTCCTGGGGG - Intergenic
1167980842 19:53273497-53273519 TTCTGTACCTGGTGTCCTGAAGG - Intergenic
925062413 2:903448-903470 GTTTCTCGCTGCTGTCCTGGGGG + Intergenic
925349338 2:3190031-3190053 TCTTCCTCTTGGTGTCCTGGGGG - Intronic
925925044 2:8664134-8664156 TTTGCTCCTTGGTCTCTTGGCGG + Intergenic
928118145 2:28562904-28562926 TTTTATCCAAGGTGTCTTGGTGG + Intronic
928356570 2:30621785-30621807 TTTTCTCACAGGGGTCCTTGGGG + Intronic
928517668 2:32059489-32059511 GTTTCTCCATGTTGTCCAGGAGG - Intergenic
929262038 2:39876611-39876633 TTTTCTTCCCTGTTTCCTGGTGG - Intergenic
929761068 2:44806551-44806573 TTTCCTCCCTGGGGGACTGGAGG - Intergenic
930422099 2:51166273-51166295 TTATCTCACAGGGGTCCTGGGGG - Intergenic
933774665 2:85764917-85764939 TCATCTGCCTGGTGACCTGGTGG - Intronic
934280018 2:91604789-91604811 TTAGCTCCCTGGTGGCATGGTGG + Intergenic
934557816 2:95296734-95296756 GTGGCTCCCTGCTGTCCTGGGGG + Intergenic
937125237 2:119471055-119471077 CTCTCTCCCTGCTGTCCTGGTGG - Intronic
937999430 2:127720121-127720143 ATTTGTCCCTGGGGTCCAGGAGG + Exonic
940420705 2:153477318-153477340 TTTTGTTCCTGGCCTCCTGGTGG - Exonic
940774319 2:157871090-157871112 TTCTCTCCCTGGGCTCCTTGAGG - Intronic
941343552 2:164338383-164338405 CTTCCTCTCTGGTGTCCTAGGGG + Intergenic
941379445 2:164775424-164775446 TTTTGTCTCTGTTGTCCTGCTGG + Intronic
942591078 2:177547608-177547630 TTTTCTCCCTGGTGTCCTGGAGG - Intergenic
943095602 2:183425311-183425333 TTTTCTCCCTGTTTGCCTGGTGG + Intergenic
945783286 2:214203703-214203725 TTGTCTCCCAGGGGTCCTTGGGG + Intronic
945978903 2:216292825-216292847 ATTACTGCCTGGTGTCCTGAAGG - Intronic
946176331 2:217923978-217924000 CTTTTTCCCTCATGTCCTGGGGG - Intronic
946491891 2:220156572-220156594 TTGTTTCCCAGGTGTCCTTGTGG - Intergenic
946644702 2:221820521-221820543 TTTATTTCCTGATGTCCTGGAGG - Intergenic
947119656 2:226800802-226800824 TTTTCTCCCTGTTATCCTTGTGG - Intergenic
947776347 2:232713911-232713933 TATTCCCCCTGGTGCCCTTGAGG + Intronic
948531117 2:238606289-238606311 TTTTCTCACAGGTGTCCTTGGGG + Intergenic
949030844 2:241796634-241796656 TTCTCTCCCTGATGGCCGGGGGG + Intronic
1169748322 20:8965354-8965376 TTTTGTCCCTTGTTTCCTGAAGG - Intronic
1170569428 20:17624653-17624675 TCTTCTCCCGGAGGTCCTGGAGG + Exonic
1170894129 20:20398834-20398856 TTTTCTCCCAGATCCCCTGGAGG - Intronic
1172104933 20:32511121-32511143 TTTTCTCCCTGAAGACCTGCAGG + Intronic
1172598007 20:36163774-36163796 TTCTCTCTCTGTGGTCCTGGTGG - Intronic
1175225014 20:57439594-57439616 TTCTCTCCCTGAGCTCCTGGTGG + Intergenic
1175308651 20:57995658-57995680 TTTTCTCTCAGGATTCCTGGAGG + Intergenic
1177403363 21:20634817-20634839 TTTTCTCACTGCAGTTCTGGAGG - Intergenic
1178089115 21:29143040-29143062 GTTTGTCCCTGGTGACCTGCAGG + Intronic
1180986923 22:19910424-19910446 TGTTCTCCCTGATGTCCTTGAGG + Intronic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1181331801 22:22098594-22098616 GTTTCACCCTGCTGTCCTGTGGG - Intergenic
1181395586 22:22618884-22618906 TTTTCTCCCTCATCTCCTGCAGG + Intergenic
1182118674 22:27773151-27773173 TTTTCTTCTTGGTGTCTCGGGGG - Intronic
1182570292 22:31232235-31232257 TTTTCTCCTGGGAGTCCTAGTGG - Intronic
1184441181 22:44517157-44517179 TCTTCTCCCTGGTGCCATGCTGG - Intergenic
950400687 3:12767312-12767334 TTTCCCCCCTGCTGTCCTGGAGG - Intronic
950662017 3:14472456-14472478 TTCTATTCCTGGTGTCCTGGAGG - Intronic
950782642 3:15405208-15405230 TATGCTCCCCAGTGTCCTGGGGG + Intronic
950940485 3:16885419-16885441 TTTTCTCCCTGGGGGAGTGGTGG + Intronic
953238955 3:41131310-41131332 TTGTTACCCTGGTGTCCTGTTGG - Intergenic
953677755 3:45016479-45016501 TTCTCTCACTGCTGTCCTGCAGG - Intronic
953916938 3:46926371-46926393 AGTTCTCACTGCTGTCCTGGTGG - Intronic
954603952 3:51894437-51894459 TTGTCTCCCTGCTGCACTGGGGG - Intergenic
954857833 3:53661887-53661909 ATTTTTCCCTGCTGACCTGGGGG - Intronic
955040708 3:55314993-55315015 TTGTCCCCCTGATGACCTGGAGG + Intergenic
955522254 3:59786205-59786227 TTTTGTCTCTGTTGTCCAGGAGG - Intronic
955540672 3:59972799-59972821 TTTTCTACCTTGTCTCCTCGAGG + Intronic
956681206 3:71783685-71783707 TTTTCTCCCTCTTCTCCTGCTGG - Intronic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
957612703 3:82489247-82489269 ATGTTTCCCTGGTGTCCTGTTGG + Intergenic
958094703 3:88928938-88928960 TTTTCTTCCTGGGGCCCTGCAGG + Intergenic
958432697 3:94060995-94061017 TGTTCTCTCTGATGTCCAGGAGG - Exonic
959314292 3:104782859-104782881 TGTTCTCCTTGGTTTCATGGAGG - Intergenic
959564184 3:107817424-107817446 CTTTCTCTCTGGTTTCCTGGAGG - Intergenic
959609695 3:108279513-108279535 TTTCCTCCCTGCTGTTCTTGTGG - Intergenic
961041773 3:123683086-123683108 GTTTCCCCATAGTGTCCTGGGGG - Intronic
961099894 3:124189741-124189763 TTTTCACCCTGTTGGCCAGGAGG - Intronic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
962238783 3:133732666-133732688 TTTTCCTTCTGGTGTGCTGGTGG - Intergenic
962729739 3:138269763-138269785 TTTTATCCTTGTAGTCCTGGAGG - Intronic
962892576 3:139685464-139685486 TTTTCACAGTGGTGCCCTGGTGG + Intergenic
968531033 4:1091762-1091784 TGTCATCCCTGCTGTCCTGGAGG - Intronic
968666782 4:1826764-1826786 TCTTCTCCCTGTCCTCCTGGGGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
969798371 4:9543449-9543471 TCTGCACCCTGATGTCCTGGGGG + Intergenic
971147390 4:23993896-23993918 TTTTCTCAGTGGTATCCTAGGGG + Intergenic
972412219 4:38806694-38806716 TTTTCCCCCTGCTGTCCAGTGGG + Intronic
974154330 4:58051534-58051556 TTTTCCCCGTGTTGGCCTGGTGG - Intergenic
977784750 4:101019716-101019738 TTTTCTCCCTGGTGATATGAAGG - Intergenic
978376878 4:108083386-108083408 TTTTATCCCTTGTCTCCGGGTGG - Exonic
978388283 4:108198583-108198605 TGTTTTCCCTGGTGTGCTGGTGG + Intergenic
980133687 4:128840583-128840605 CTTTCTCCCTCTTGTCCTGGAGG - Intronic
981193220 4:141887691-141887713 TTTCCTCCCTGGCTGCCTGGAGG - Intergenic
981471616 4:145141776-145141798 TTTCCTTCTTGGTGTCCAGGAGG - Intronic
983252510 4:165360729-165360751 TTATTTCCATGGTGTACTGGAGG - Intergenic
983731917 4:171005532-171005554 TTATCTTCTTGGTGTCCTGTTGG + Intergenic
985936324 5:3100893-3100915 TTCTCTCCCTTGGGCCCTGGTGG + Intergenic
988799981 5:34687545-34687567 TTTTCTCCCTCTTCTCCTGGGGG - Intronic
989368909 5:40684497-40684519 TTTCTTCCCTGGTGTCCAGGAGG - Intronic
990543656 5:56800241-56800263 TTTTCCCCCTGGGACCCTGGAGG + Intergenic
991248010 5:64528332-64528354 TTTTTTGCCTGGTGTATTGGTGG + Intronic
992834750 5:80629134-80629156 TGTTCTCTCTGATGTCCAGGAGG - Exonic
995341672 5:111067826-111067848 TTTTATGACTTGTGTCCTGGAGG + Intergenic
996106819 5:119514712-119514734 TTTTCTCCATTGTGGCCTGGAGG + Intronic
997362258 5:133302616-133302638 TTTACTCACTGCTGTCCTGGTGG - Intronic
997951507 5:138246116-138246138 TTCCCACCCTGCTGTCCTGGGGG - Intergenic
999157887 5:149471597-149471619 TCTTCTCTCTAGTGCCCTGGAGG - Intergenic
999235345 5:150087630-150087652 TTTGCTCCCTCTTTTCCTGGAGG + Intronic
1000514912 5:162227635-162227657 TTTTCCCCATGCTGTTCTGGTGG - Intergenic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1000946622 5:167429945-167429967 TCTTCTCCCAGGTTTCCTTGTGG - Intronic
1001801625 5:174549205-174549227 TTTTCTCCTTGGTGTCATGAAGG + Intergenic
1001832198 5:174798318-174798340 CTTTCTCCTTAGTTTCCTGGGGG + Intergenic
1002534735 5:179869973-179869995 CTGTCTCCCTGGCGTCCTGCTGG + Intronic
1002940951 6:1715470-1715492 ATTTCCACCTGGGGTCCTGGGGG - Intronic
1003927242 6:10887663-10887685 TCTTCTGCCTGGGTTCCTGGTGG + Intronic
1004240619 6:13917957-13917979 TCCTCTCCCTTATGTCCTGGAGG + Intergenic
1004596379 6:17103454-17103476 TTTAGTACCTGGTGCCCTGGGGG + Intronic
1004891052 6:20101076-20101098 TTTTCTCCCTCATTTCATGGAGG - Intergenic
1005388015 6:25305093-25305115 TTATCTTCCTGCTGTCCTGGTGG + Intronic
1007070994 6:39037984-39038006 TTCTCTTCCTCCTGTCCTGGAGG + Intergenic
1007507774 6:42349540-42349562 TTTCCTACCTGGTGTCCTGAAGG + Intronic
1007893629 6:45322910-45322932 TTTTCTCCATGGACTCATGGTGG - Exonic
1007945842 6:45826175-45826197 TTTTCTCTCTGTTGTCAAGGTGG + Intergenic
1008453942 6:51686444-51686466 TTTTCTCCCAGGTGTTCCTGTGG + Intronic
1008855139 6:56075498-56075520 TTTTTTCCTTGCTGTCCTGGAGG + Exonic
1009545301 6:65012010-65012032 TTTTCTTTCTGGTACCCTGGAGG + Intronic
1010449203 6:75983623-75983645 TTTTCTCCCTTGTGTTCTTCTGG - Intronic
1010766464 6:79781436-79781458 TTTTCTCCCAGGTATCATGCAGG - Intergenic
1012786127 6:103628855-103628877 TTTTCTCTCTGGAGTCATGCAGG - Intergenic
1013137852 6:107299803-107299825 ATTACTCCCAGTTGTCCTGGGGG + Intronic
1014638557 6:123879941-123879963 TGTTCTCCCTGGTGTCTTGGGGG + Intronic
1015996863 6:139003949-139003971 TCTTCTCCCAGATGTCATGGGGG + Intergenic
1017854583 6:158339159-158339181 TTTTAAAGCTGGTGTCCTGGGGG + Intronic
1022264566 7:28741429-28741451 CTTTCTCCCTGAAGTCCAGGTGG - Intronic
1022425749 7:30267234-30267256 TTTTCTCACTGCTTTCCTAGAGG + Intergenic
1022779017 7:33559326-33559348 TTTAATTCCTGGTGTCTTGGGGG + Intronic
1023117384 7:36875718-36875740 TTTTCACCCTGGAGTCTTGGGGG + Intronic
1023371751 7:39518854-39518876 TTCTCTCCCTTGTCTCATGGAGG + Intergenic
1023542867 7:41285006-41285028 TTTTCTCCCTGTTGGCCAGCTGG - Intergenic
1027244467 7:76358292-76358314 TTCTCTCCCTGGTGTCTGGGCGG - Intronic
1028085029 7:86625868-86625890 GTTTCTCCCTGGATTCATGGAGG - Intergenic
1028108480 7:86909345-86909367 TTTTGTCTCTGTAGTCCTGGAGG - Intronic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1032011149 7:128349036-128349058 ATTTCTCACTGGTGTCATAGTGG - Intergenic
1032430025 7:131853167-131853189 CATCCTCCCTGGTGTCCTGATGG - Intergenic
1032594134 7:133222608-133222630 TTTTCTCCCTGTTGGGCTAGAGG - Intergenic
1033092566 7:138399881-138399903 TATTATCCCTTGGGTCCTGGGGG + Intergenic
1034220369 7:149440281-149440303 TTTTCTGTTTGGTGACCTGGGGG + Intronic
1034497732 7:151432327-151432349 TTTTCTCTCCGGAGTCCCGGGGG - Intronic
1035245337 7:157559345-157559367 GGGTCTCCCTGTTGTCCTGGAGG - Intronic
1035756070 8:2033965-2033987 TCTTCACCGTTGTGTCCTGGAGG - Intergenic
1035912278 8:3580602-3580624 TTTTCTCCCAGGTGACCTTCAGG + Intronic
1036244264 8:7103150-7103172 TCTGCATCCTGGTGTCCTGGGGG + Intergenic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036361004 8:8076903-8076925 TTTGCACCCTGGTGTCCTGGGGG + Intergenic
1036427365 8:8657236-8657258 TTTTCTCCCTGGCTGGCTGGTGG - Intergenic
1036649895 8:10635425-10635447 TGCTCTCCCAGGTGTCCTGAAGG + Intronic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1037193365 8:16155120-16155142 TTTTCACCCGGGGGTCCAGGAGG + Exonic
1037299360 8:17434816-17434838 TTTTCTCCCTCCTGCCCAGGAGG - Intergenic
1039432101 8:37532938-37532960 TTCTGTTCCTGGTGTCCTGAGGG + Intergenic
1040014273 8:42688648-42688670 TTTGCTTCCTGGTGTCCTGATGG + Intergenic
1040089895 8:43387017-43387039 TTTTGTCCCTGTTGTCAGGGTGG - Intergenic
1040577609 8:48667515-48667537 TTTTCTCCTTGCTGTCCTCCTGG - Intergenic
1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG + Intergenic
1042671291 8:71266302-71266324 TTTTCTCCTCAGTGCCCTGGGGG + Intronic
1043064110 8:75544271-75544293 TTTTCTCCCTCGTCTCCTAGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047211792 8:122846438-122846460 CTTGCTCCCTGGTTCCCTGGTGG - Intronic
1047628562 8:126681354-126681376 TGTTCTCCATGGTCTTCTGGAGG + Intergenic
1048162193 8:132031786-132031808 GTTTCAGCCTGGTGTCCAGGAGG + Intronic
1048204141 8:132402022-132402044 TTTTCTCCTTGCAGACCTGGGGG + Intronic
1048802531 8:138207121-138207143 TTTTCTCCCTGATTTCCATGAGG - Intronic
1049233202 8:141494850-141494872 TTTTCTCCCAGGTCTCCTCCAGG + Intergenic
1050004748 9:1118485-1118507 TTTTCTCCATGGTGGCCCGTGGG + Intergenic
1051073400 9:13201517-13201539 TTTTCTCTCTGGTCTCCTTCAGG + Intronic
1053265622 9:36711124-36711146 TTTCTTCCCTAGTGGCCTGGAGG - Intergenic
1053441528 9:38120414-38120436 TTTTCTCCCTGCTGCTCTAGAGG + Intergenic
1053751212 9:41257921-41257943 TTTTCTCCTTAGTGTCTTTGTGG - Intergenic
1054256734 9:62822250-62822272 TTTTCTCCTTAGTGTCTTTGTGG - Intergenic
1054334573 9:63793362-63793384 TTTTCTCCTTAGTGTCTTTGTGG + Intergenic
1054736882 9:68762298-68762320 TTTTCTCCCTGCTGAGCAGGTGG + Intronic
1056858551 9:90158196-90158218 TTTTCTCCCTGTGGCCCTGTTGG + Intergenic
1056964538 9:91154955-91154977 TTTTCTGCCTGGGTTCCTTGTGG - Intergenic
1057215281 9:93224451-93224473 GTGTTTCCCAGGTGTCCTGGGGG + Intronic
1059385133 9:113958700-113958722 CTTTCTTCCTGGTGTACTGCTGG + Intronic
1061237638 9:129351860-129351882 TTTTCTCTCTGGGGCCCTCGGGG + Intergenic
1062133843 9:134914405-134914427 TTCTCTCCTCGGTCTCCTGGAGG + Exonic
1062563532 9:137152486-137152508 TTTTCTCTCCCGTGTCCTGTTGG - Intronic
1187245118 X:17547011-17547033 TTTCCTCCCTGGGGTCCAGGAGG + Intronic
1187564202 X:20432479-20432501 TTTTCAGCCATGTGTCCTGGGGG + Intergenic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1188564238 X:31507453-31507475 TCTTCTTCCTGCTGTCCTGTAGG - Exonic
1190264108 X:48817353-48817375 TGCTCTGCGTGGTGTCCTGGGGG - Exonic
1190549376 X:51563314-51563336 TTCTCTCCCTGGTGTTCCGGTGG - Intergenic
1190691130 X:52914040-52914062 TTTGCTCCCTGCTGTGCTGGCGG + Intergenic
1190694853 X:52941752-52941774 TTTGCTCCCTGCTGTGCTGGCGG - Intronic
1191997869 X:67115760-67115782 TTTTCTCCCTGAAGAACTGGTGG - Intergenic
1192601546 X:72469611-72469633 TTTTCTCTCTGTTCTGCTGGAGG + Intronic
1192921688 X:75713563-75713585 TTCTCTCACTGGGGTCCTTGGGG - Intergenic
1193541339 X:82775867-82775889 TTGTCTCACAGGTGTCCTTGGGG - Intergenic
1193587535 X:83343905-83343927 TTTTCTGCATGGTGTCCAGTGGG - Intergenic
1195327048 X:103766390-103766412 TTTTCTCTCTACTTTCCTGGGGG - Intergenic
1195392683 X:104379281-104379303 TTTTCTCCCAGGTTTCCTCATGG + Intergenic
1195798250 X:108677619-108677641 TTTCCTACCTGGAGTCCTGGTGG - Exonic
1199586760 X:149423179-149423201 TTATCTCACAGGTGTCCTTGGGG + Intergenic
1200146722 X:153930227-153930249 GCTTCTCCCTGGGTTCCTGGTGG - Intronic
1201784351 Y:17757774-17757796 TTTTCTCTCTGTTGTCCTTGGGG + Intergenic
1201817202 Y:18148213-18148235 TTTTCTCTCTGTTGTCCTTGGGG - Intergenic
1201934745 Y:19396380-19396402 TTTTCTCCCTGGGGTCTTCATGG - Intergenic