ID: 942592232

View in Genome Browser
Species Human (GRCh38)
Location 2:177558427-177558449
Sequence ATGTCTGCCTGGAAAAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942592229_942592232 7 Left 942592229 2:177558397-177558419 CCAAGATTGTAGAGCCATTGACA No data
Right 942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG No data
942592227_942592232 9 Left 942592227 2:177558395-177558417 CCCCAAGATTGTAGAGCCATTGA No data
Right 942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG No data
942592230_942592232 -7 Left 942592230 2:177558411-177558433 CCATTGACAATGTGCAATGTCTG No data
Right 942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG No data
942592226_942592232 18 Left 942592226 2:177558386-177558408 CCTTTGGGACCCCAAGATTGTAG No data
Right 942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG No data
942592228_942592232 8 Left 942592228 2:177558396-177558418 CCCAAGATTGTAGAGCCATTGAC No data
Right 942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942592232 Original CRISPR ATGTCTGCCTGGAAAAGCTA TGG Intergenic
No off target data available for this crispr