ID: 942593633

View in Genome Browser
Species Human (GRCh38)
Location 2:177571606-177571628
Sequence AAGGTACTCACCTGCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942593628_942593633 9 Left 942593628 2:177571574-177571596 CCTCTCTCTCTGCCATGCGAGGA No data
Right 942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG No data
942593626_942593633 16 Left 942593626 2:177571567-177571589 CCTCTCTCCTCTCTCTCTGCCAT No data
Right 942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG No data
942593625_942593633 23 Left 942593625 2:177571560-177571582 CCTCTCTCCTCTCTCCTCTCTCT 0: 17
1: 57
2: 230
3: 1201
4: 4686
Right 942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG No data
942593629_942593633 -3 Left 942593629 2:177571586-177571608 CCATGCGAGGACCCAGCAAGAAG No data
Right 942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942593633 Original CRISPR AAGGTACTCACCTGCAAGCC AGG Intergenic
No off target data available for this crispr