ID: 942598172

View in Genome Browser
Species Human (GRCh38)
Location 2:177612314-177612336
Sequence AGAATGTAAGCTCTGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 2, 2: 25, 3: 76, 4: 827}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942598172 Original CRISPR AGAATGTAAGCTCTGGCTCC TGG Intergenic
900261733 1:1734288-1734310 TCACTGTAACCTCTGGCTCCTGG + Intronic
900383106 1:2395129-2395151 ACAATGTGACCTCTGGCACCTGG + Intronic
900967081 1:5966318-5966340 ACACTGTAATCTCTGCCTCCTGG + Intronic
901388630 1:8927805-8927827 GGAGTGTAACCTCTGCCTCCTGG - Intergenic
901548915 1:9980546-9980568 TCACTGTAACCTCTGGCTCCTGG - Intronic
902006851 1:13238968-13238990 TCAATGCAAGCTCTGCCTCCCGG - Intergenic
902302645 1:15513084-15513106 ACACTGCAAGCTCTGCCTCCTGG - Intronic
902435987 1:16398317-16398339 AGAATGAGAGCCCTGGGTCCTGG + Intronic
902697454 1:18149955-18149977 AGAATGTAGGCTTTGGGGCCGGG + Intronic
903745352 1:25582995-25583017 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
905454143 1:38075975-38075997 AGATTGTAAGGTCAGGATCCAGG - Intergenic
905660919 1:39724194-39724216 AGAGTGCAACCTCTGCCTCCTGG + Intronic
906287904 1:44599833-44599855 AGAATGTATGCTGTGGCTTTAGG + Intronic
906388274 1:45390990-45391012 TCACTGTAAGCTCTGCCTCCCGG + Intronic
906849477 1:49232622-49232644 TCACTGTAAGCTCTGCCTCCTGG - Intronic
907103105 1:51854988-51855010 AGAATGTTAGCACTGGCTCATGG - Intronic
907622419 1:55995072-55995094 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
907806446 1:57825164-57825186 TGAAACAAAGCTCTGGCTCCTGG + Intronic
909134909 1:71785832-71785854 ATAATGTAACACCTGGCTCCTGG + Intronic
909143582 1:71898538-71898560 TCACTGCAAGCTCTGGCTCCCGG - Intronic
909513267 1:76478835-76478857 TCACTGTAAGCTCTGCCTCCTGG + Intronic
910127112 1:83854885-83854907 AAAATGTAAACTCTGGATCCAGG + Intergenic
910164551 1:84311259-84311281 TCAATGTAACCTCTGCCTCCTGG - Intronic
910734291 1:90435121-90435143 AGAATGAAAACTTTTGCTCCGGG + Intergenic
911024481 1:93422605-93422627 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
911408139 1:97467290-97467312 AGAATGTTAGCTCTGGCTCTTGG - Intronic
911572623 1:99536177-99536199 TCACTGTAAGCTCTGTCTCCCGG + Intergenic
911644340 1:100322048-100322070 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
911940894 1:104046135-104046157 AGAATATAAACTCTGGTTACTGG + Intergenic
912461341 1:109833933-109833955 TGAATGCAACCTCTGCCTCCCGG + Intergenic
912609155 1:111025464-111025486 AGAATTTAAGTTCTGACTACTGG - Intergenic
913268161 1:117065520-117065542 TCACTGTAAGCTCTGCCTCCGGG - Intronic
914821012 1:151103122-151103144 TCACTGCAAGCTCTGGCTCCCGG + Intronic
915180089 1:154051282-154051304 TCACTGTAAGCTCTGCCTCCTGG + Intronic
915331825 1:155117338-155117360 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
915810945 1:158909972-158909994 AGACTCCAAGCCCTGGCTCCTGG + Intergenic
916024899 1:160824903-160824925 TCACTGTAAGCTCTGCCTCCTGG - Intronic
916047746 1:161013448-161013470 AGAGTGGAAGCTCTAGGTCCAGG - Intronic
916073874 1:161188790-161188812 TCACTGTAAGCTCTGCCTCCCGG + Exonic
916728259 1:167543170-167543192 TCACTGTAAGCTCTGCCTCCTGG - Intronic
916732769 1:167581243-167581265 AGAACGTCAGCTCTGGCTCGTGG + Intergenic
916901247 1:169226277-169226299 AGAATGTATGATCTAGCTCTAGG - Intronic
916902560 1:169245052-169245074 TCACTGTAAGCTCTGCCTCCTGG - Intronic
917055143 1:170972735-170972757 TCACTGTAAGCTCTGCCTCCTGG - Intronic
917098407 1:171422652-171422674 AGAATGTTACCTCTGACTCGTGG - Intergenic
917250250 1:173051701-173051723 AGAGTATAAGCTCTGGCTGAGGG - Intergenic
917368986 1:174268272-174268294 TCACTGTAAGCTCTGCCTCCCGG + Intronic
917634887 1:176925878-176925900 TCACTGTAAGCTCTGCCTCCCGG + Intronic
917688447 1:177442561-177442583 AGAATGAAAACTTTGCCTCCTGG + Intergenic
918000574 1:180490709-180490731 TCACTGTAAGCTCTGCCTCCTGG - Intronic
918183818 1:182109861-182109883 TCAATGTAACCTCTGCCTCCTGG - Intergenic
918992813 1:191720680-191720702 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
919259221 1:195168610-195168632 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
919628159 1:199932991-199933013 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
919675629 1:200379626-200379648 AAAATGTAAGCACTGGCTCATGG + Intergenic
919952971 1:202382799-202382821 TCACTGTAACCTCTGGCTCCAGG - Intronic
920089806 1:203444335-203444357 AGAATGTAAACCCTGCCTCTTGG + Intergenic
920845203 1:209587890-209587912 AGAATGTGCTCTCTGCCTCCAGG - Intronic
921266008 1:213421184-213421206 ACACTGTAACCTCTGCCTCCAGG + Intergenic
921806279 1:219459123-219459145 TGAATGCAACCTCTGCCTCCTGG - Intergenic
922478095 1:225920663-225920685 AGACTCAAAGCTCTGGCCCCAGG - Intronic
922528874 1:226327750-226327772 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
922604955 1:226884256-226884278 AGAAAGCAAGCTCTTGATCCTGG + Intronic
923040283 1:230315083-230315105 GGAAGCTAAGCCCTGGCTCCTGG - Intergenic
923064461 1:230505212-230505234 AGAATGTTAGCTCTGGTTTGTGG + Intergenic
923201197 1:231713185-231713207 ATAATGTAAACTCTGGCTATCGG - Intronic
923254921 1:232213503-232213525 AGAATGTAGGCACTGGCAACTGG - Intergenic
923388389 1:233488874-233488896 AGAATGAAAACTCTAGCTTCAGG - Intergenic
923622918 1:235592558-235592580 AAAATGTTAGCTCTGGCTTGTGG - Intronic
924760151 1:246976717-246976739 ACACTGCAAGCTCTGCCTCCCGG - Intronic
924796316 1:247295197-247295219 AGAATGTTAGGTCTGGCTCTTGG + Intergenic
924804838 1:247353915-247353937 AAACTGTAACCTCTGCCTCCTGG - Intergenic
1063808575 10:9677378-9677400 TCAATGCAAGCTCTGCCTCCCGG - Intergenic
1063821647 10:9843237-9843259 TGACTGTAACCTCTGCCTCCTGG + Intergenic
1063968433 10:11364517-11364539 AGAATGTTAGCTCCAGCTCATGG - Intergenic
1064169695 10:13019157-13019179 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1064803215 10:19099835-19099857 AGATTGCAACCTCTGCCTCCCGG + Intronic
1064961642 10:20971686-20971708 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1065173090 10:23051317-23051339 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
1065378584 10:25066643-25066665 AGAATGTTAGCTCTGGCTCGTGG - Intergenic
1065432235 10:25671273-25671295 AGAATGGGAGCTCTTGCTCATGG + Intergenic
1065443785 10:25776545-25776567 AGAATGTGAGCTCTGGCTTGTGG - Intergenic
1065487378 10:26248335-26248357 AGAATGCTAGCTCTGGCCCAGGG + Intronic
1065773166 10:29096258-29096280 AGAATGTTAGCTCTGGCTCATGG + Intergenic
1065878951 10:30023110-30023132 TCACTGTAACCTCTGGCTCCCGG + Intronic
1066324527 10:34344355-34344377 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1066652173 10:37666603-37666625 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1067196889 10:44127855-44127877 AGTATCTAAGCTCTGGCTCTGGG + Intergenic
1067446341 10:46350014-46350036 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1067547551 10:47205207-47205229 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1067797035 10:49328148-49328170 GGAATGTTAGCTCTGGCTTGTGG + Intergenic
1068127283 10:52855904-52855926 ACAATGCAACCTCTGCCTCCTGG - Intergenic
1068225273 10:54100288-54100310 TGACTGTAACCTCTGCCTCCCGG - Intronic
1068448980 10:57162393-57162415 AGAATGTAATCTGTGACTCACGG - Intergenic
1068978769 10:63038507-63038529 TCACTGCAAGCTCTGGCTCCTGG - Intergenic
1069098426 10:64288342-64288364 AGAAGGTGAGCTCTGGAGCCAGG - Intergenic
1069181424 10:65364651-65364673 TCACTGCAAGCTCTGGCTCCCGG + Intergenic
1069214670 10:65804404-65804426 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1069430482 10:68330618-68330640 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1069442390 10:68440370-68440392 TGACTGTAAGCTCTGCCTCCCGG + Intronic
1070134760 10:73683276-73683298 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1071051777 10:81459262-81459284 AGAATATTAGCTCTGGCTCATGG - Intergenic
1071052945 10:81473465-81473487 AGCATCTAAGTTCTAGCTCCAGG - Intergenic
1071133833 10:82430330-82430352 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1071831138 10:89373258-89373280 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1071848147 10:89540994-89541016 TCAATTTAAGCTCTGCCTCCTGG + Intronic
1072015389 10:91341722-91341744 AGAATGTTAGCTCTGGCTCATGG - Intergenic
1072117936 10:92381661-92381683 AGAATGTTAGCTCTGGCTCACGG + Intergenic
1072127666 10:92461737-92461759 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1072281721 10:93871624-93871646 AGAATGTTAGCTCTGGCTTATGG - Intergenic
1072288041 10:93935541-93935563 TGACTGTAACCTCTGCCTCCTGG - Intronic
1072647826 10:97272913-97272935 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1072698699 10:97623808-97623830 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1073368814 10:102968319-102968341 TGACTGTAACCTCTGCCTCCTGG + Intronic
1073849608 10:107599485-107599507 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1073870207 10:107854687-107854709 TGACTGCAAGCTCTGACTCCCGG + Intergenic
1073966700 10:108998475-108998497 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1074473928 10:113752670-113752692 AGAGTGTTAGCTCTGGCATCTGG - Intronic
1074706924 10:116141466-116141488 AGAGTATATGCTCTGCCTCCTGG + Intronic
1074730445 10:116367613-116367635 AGGCTGCAAGCTCTGCCTCCTGG - Intronic
1074981878 10:118626555-118626577 AAAATGTTAGCTCCGGCTCCTGG + Intergenic
1075292489 10:121242348-121242370 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1075297406 10:121290394-121290416 AAAATATAAGATCTGGCTGCAGG - Intergenic
1075327615 10:121547147-121547169 ACACTGTAACCTCTGCCTCCCGG - Intronic
1075751995 10:124779986-124780008 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1076165505 10:128279170-128279192 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1077514652 11:2994068-2994090 ACACTGTAAGCTCCGCCTCCCGG - Intergenic
1077564256 11:3286519-3286541 TGACTGTAAGCTCTGCCTCCCGG + Intergenic
1077570146 11:3332336-3332358 TGACTGTAAGCTCTGCCTCCCGG + Intergenic
1078178718 11:8991224-8991246 TCAATGCAAGCTCTGCCTCCCGG - Intronic
1078214580 11:9300801-9300823 ACACTGCAAGCTCTGCCTCCCGG - Intronic
1078221084 11:9352265-9352287 AGAATGTAAGCTGGAGCTGCTGG + Intergenic
1078303624 11:10159813-10159835 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1078893228 11:15576332-15576354 CGACTGTAACCTCTGCCTCCTGG - Intergenic
1079419530 11:20273062-20273084 AGAATGTAAGGACTGGCTGTAGG + Intergenic
1079637736 11:22765702-22765724 ACACTGCAAGCTCTGCCTCCTGG - Intronic
1079850839 11:25532338-25532360 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1079907510 11:26267015-26267037 TGACTGCAAGCTCTGCCTCCAGG - Intergenic
1080017723 11:27525141-27525163 ACAAAGAAAACTCTGGCTCCTGG + Intergenic
1080522543 11:33080020-33080042 TGAATGCAACCTCTGCCTCCCGG - Intronic
1080527218 11:33135547-33135569 AGTTTGTAAACTTTGGCTCCAGG + Intronic
1080624725 11:34017818-34017840 AGGCTGGAAGCTCTGCCTCCCGG - Intergenic
1080762446 11:35265021-35265043 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1080788109 11:35494406-35494428 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1081240351 11:40697991-40698013 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1081259738 11:40945100-40945122 ACACTGCAAGCTCTGCCTCCCGG + Intronic
1081849872 11:46267714-46267736 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1082804316 11:57437888-57437910 AGAATGGAAACTGAGGCTCCGGG - Intergenic
1083444401 11:62697980-62698002 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1083971068 11:66075810-66075832 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1084079525 11:66812249-66812271 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1084493059 11:69488716-69488738 AGACTGGAAGGCCTGGCTCCTGG - Intergenic
1085099157 11:73785985-73786007 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1085794693 11:79528199-79528221 GGAATGTGAGCTCTGGGCCCTGG + Intergenic
1086155715 11:83663648-83663670 AGATTGTATGCTCTGACTCAGGG + Intronic
1086593220 11:88540819-88540841 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1086781402 11:90910622-90910644 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1086802374 11:91193112-91193134 AGAACGTTAGCTCTAGCTCATGG - Intergenic
1086842071 11:91698475-91698497 TCAATGCAAGCTCTGCCTCCTGG - Intergenic
1087458327 11:98415743-98415765 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1088749494 11:112831685-112831707 AGGCTGCAAGCTCTGCCTCCCGG - Intergenic
1089476717 11:118769777-118769799 TCACTGCAAGCTCTGGCTCCCGG + Intronic
1089577751 11:119458833-119458855 AGAATGTTCGCTCTGGCTTGTGG + Intergenic
1089954919 11:122561278-122561300 TCACTGTAACCTCTGGCTCCCGG - Intergenic
1090101168 11:123798182-123798204 AAAATGTTTGCTCTGGCTCGTGG + Intergenic
1090589317 11:128248325-128248347 AGAATTTGGGCTCTGGCACCCGG + Intergenic
1090752665 11:129760874-129760896 GCAATCTAAGCTCTGGATCCTGG - Intergenic
1090914643 11:131152518-131152540 AGCATGTGAGCTCTGGCTCATGG + Intergenic
1091133879 11:133170409-133170431 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1091284768 11:134402460-134402482 AGGATGCAGGCTCAGGCTCCTGG + Intronic
1091883882 12:4002239-4002261 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1092221242 12:6715474-6715496 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1092222605 12:6725229-6725251 TGAGTGCAAGCTCTGCCTCCTGG + Intronic
1092377358 12:7967058-7967080 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1092482231 12:8870340-8870362 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1092888921 12:12950730-12950752 TCAATGTAAACTCTGTCTCCTGG - Intronic
1094318573 12:29159461-29159483 TCATTGTAAGCTCTGCCTCCTGG - Intronic
1094613036 12:32012002-32012024 TCACTGTAACCTCTGGCTCCCGG + Intergenic
1094675838 12:32619555-32619577 TCATTGTAAGCTCTGCCTCCCGG - Intronic
1095062311 12:37712843-37712865 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1095200790 12:39381231-39381253 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1095808074 12:46343114-46343136 TGACTGTAGGTTCTGGCTCCTGG - Intergenic
1095861843 12:46925962-46925984 AGGATCCAAGCTCTGGCTCCTGG + Intergenic
1096314907 12:50556122-50556144 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1096682152 12:53263001-53263023 ACACTGTAACCTCTGCCTCCTGG - Intergenic
1096702680 12:53396204-53396226 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1097204751 12:57311298-57311320 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1097229306 12:57499527-57499549 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1097362632 12:58674768-58674790 TCACTGTAAGCTCTGCCTCCAGG + Intronic
1097457296 12:59815427-59815449 AGAATGTAACCTCCGCCTCCTGG + Intergenic
1097865257 12:64554795-64554817 AGAATATAAGCTCTGGCAGCAGG + Intergenic
1098247300 12:68533737-68533759 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1098560195 12:71864580-71864602 TGACTGTAATCTCTGCCTCCTGG + Intronic
1098782008 12:74699545-74699567 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1098945542 12:76585440-76585462 AAAAAGTTAGCTCTGGCTGCAGG + Intergenic
1099285939 12:80714551-80714573 AGAAAGTAAACTCGAGCTCCAGG - Intergenic
1099670276 12:85682568-85682590 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1099781186 12:87197829-87197851 CCAATGCAAGCTCTGCCTCCTGG + Intergenic
1100127614 12:91447920-91447942 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1100256542 12:92888500-92888522 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1100521271 12:95378476-95378498 GGAGTGCAAGCTCTGCCTCCCGG + Intronic
1101032898 12:100677552-100677574 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1101698684 12:107151485-107151507 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
1102073043 12:110037479-110037501 GGAATGGGAGCTCCGGCTCCAGG + Exonic
1102855066 12:116286524-116286546 AGAAAGCAAGATCTGGCCCCGGG - Intergenic
1102871096 12:116414387-116414409 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1103720692 12:122973784-122973806 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1103936363 12:124479658-124479680 AGAATTTTAGCTCAGCCTCCTGG - Intronic
1104321005 12:127750695-127750717 GGAATGTAAGTTATGGCTCTCGG + Intergenic
1104665982 12:130647618-130647640 AGAATGTTAGCTCTGGCTCATGG - Intronic
1104706512 12:130951466-130951488 AGAATGTTAGCTCTGGCCTGTGG - Intergenic
1105045946 12:133003327-133003349 ACACTGCAAGCTCTGCCTCCTGG + Intronic
1105385156 13:19922767-19922789 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1105808189 13:23971096-23971118 ACACTGCAAGCTCTGCCTCCCGG - Intergenic
1105888014 13:24659038-24659060 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1106415293 13:29541182-29541204 AAAATGTAAGTTCTTGCACCTGG - Intronic
1106426217 13:29632979-29633001 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1106428852 13:29659775-29659797 TGAATGCAACCTCTGCCTCCTGG - Intergenic
1106739176 13:32620580-32620602 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1107647048 13:42505294-42505316 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1107868329 13:44725389-44725411 TGACTGTAAGCTCCGCCTCCCGG + Intergenic
1108302109 13:49089271-49089293 ATTATTTAAGCTCTGGCTTCAGG - Intronic
1108663293 13:52605512-52605534 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1108667338 13:52645663-52645685 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1109308083 13:60662431-60662453 TCAATGTAAGCTCTCCCTCCTGG + Intergenic
1109362548 13:61315099-61315121 TCAATGCAAGCTCTGCCTCCTGG + Intergenic
1109629968 13:65033177-65033199 AGATTGTGAGCTTTGGCTTCAGG + Intergenic
1110144167 13:72169069-72169091 AGAACCTTAGCTCTGGCTCATGG - Intergenic
1110273418 13:73616547-73616569 GGAATGTAGGCTCTGGAACCAGG - Intergenic
1110913223 13:80989903-80989925 AGAATGTTAGCTCTGGCTCATGG + Intergenic
1111594976 13:90399861-90399883 AGAATGTTAGCCCCGGCTCATGG - Intergenic
1111651081 13:91091675-91091697 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1112237730 13:97651278-97651300 AGCAGGAAAGCCCTGGCTCCTGG - Intergenic
1112294442 13:98174411-98174433 AAACTCTAAGCTCTGGCTCCAGG - Intronic
1112295148 13:98179780-98179802 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1112311662 13:98322601-98322623 AGCATGTAAGCTCCGGGTCTTGG - Intronic
1113829752 13:113286335-113286357 AGAATGTGGGCTTTGGCACCAGG - Intergenic
1113937783 13:114003811-114003833 AGATTGTGAGGTCCGGCTCCAGG + Intronic
1114229186 14:20765269-20765291 AGAATGTTAGCTTTGGATCATGG - Intergenic
1114296701 14:21335754-21335776 GGAGTGCAAGCTCTGCCTCCTGG - Intronic
1114440107 14:22739387-22739409 AGAATGTTAGCTCTGGTTTATGG + Intergenic
1115042621 14:28949433-28949455 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1115358665 14:32477043-32477065 AGAAAGTTAGCTCTGGCTCATGG + Intronic
1116057940 14:39886389-39886411 TGACTCTAGGCTCTGGCTCCTGG + Intergenic
1116107418 14:40527738-40527760 ACACTGCAAGCTCTGCCTCCTGG + Intergenic
1116264004 14:42663936-42663958 TGAATATAAGCTCTGGAACCAGG - Intergenic
1116267178 14:42707902-42707924 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1116414431 14:44663400-44663422 AGAATGTTAGCTCTGGCTTATGG - Intergenic
1116483975 14:45424784-45424806 TCAATGTAACCTCTGCCTCCTGG + Intergenic
1117380754 14:55160520-55160542 TCAATGTAACCTCTGCCTCCCGG + Intronic
1117730173 14:58714453-58714475 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1118406271 14:65426931-65426953 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1118598566 14:67454922-67454944 AGAGTGCAACCTCTGCCTCCTGG + Intronic
1118647652 14:67855303-67855325 TCAATGTAAGCTCCGCCTCCCGG + Intronic
1118800099 14:69182115-69182137 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1118835415 14:69474387-69474409 AGAATGTTAGCTCTGGCCCATGG - Intergenic
1118927547 14:70206650-70206672 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1118953040 14:70452438-70452460 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1119338941 14:73858476-73858498 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1119952510 14:78760013-78760035 AGACTGCAGGCTCTGGGTCCTGG - Intronic
1120120042 14:80667781-80667803 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1120318515 14:82928774-82928796 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1120626338 14:86831585-86831607 GGAATGTAGGCTTGGGCTCCTGG - Intergenic
1120966819 14:90174918-90174940 AGAATGTTAGCTCTGGCTAATGG + Intronic
1121469255 14:94139147-94139169 AGAATGTGTGGTCTGGATCCTGG - Intergenic
1121536403 14:94694150-94694172 TTAATGCAAGCTCTGCCTCCCGG + Intergenic
1121714843 14:96066162-96066184 TGAATGCAAGCTGTGGCTCTGGG + Intronic
1122372758 14:101237689-101237711 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1122444522 14:101759916-101759938 AGAAAGTAAGTTCTGTCTGCGGG - Intergenic
1122485630 14:102077758-102077780 ACACTGCAAGCTCTGCCTCCTGG + Intergenic
1122511991 14:102276412-102276434 TCAATGCAAGCTCTGACTCCTGG - Intronic
1122605677 14:102946081-102946103 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1123010847 14:105348873-105348895 AGCAGGGAAGCCCTGGCTCCAGG - Intronic
1123137342 14:106040324-106040346 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1123767531 15:23496330-23496352 AGAAGGTTAGCTCTAACTCCTGG + Intergenic
1123794111 15:23754513-23754535 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1124559305 15:30757184-30757206 AGAATGTTAGCTCTGGTCTCTGG + Intronic
1124876394 15:33598978-33599000 TCACTGTAAGCTCTGTCTCCTGG - Intronic
1125048344 15:35269509-35269531 AGGCTGGAAGCTCTGCCTCCCGG + Intronic
1125349899 15:38755598-38755620 ATAATGTTAGCTCTGGCTCATGG - Intergenic
1125710774 15:41783932-41783954 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1125712140 15:41795679-41795701 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1125840250 15:42793771-42793793 ACAATCTCAGCTCTGCCTCCTGG - Intronic
1126119511 15:45239358-45239380 AGGATGGAAGCCCTGGCTGCAGG + Intergenic
1126219150 15:46192611-46192633 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1126654835 15:50965990-50966012 TGACTGTAACCTCTGCCTCCCGG + Intronic
1127121493 15:55775973-55775995 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1127127882 15:55830991-55831013 TCAATGCAACCTCTGGCTCCTGG + Intronic
1128119533 15:65135216-65135238 TCATTGTAAGCTCTGCCTCCTGG + Intergenic
1128193487 15:65727376-65727398 TCAATGTAAGCTCCGCCTCCTGG - Intronic
1128456046 15:67832034-67832056 GGAATCTAGGCCCTGGCTCCAGG - Intronic
1128725982 15:69988949-69988971 TGAATTTAAGCTCTGGTTCCAGG + Intergenic
1128808153 15:70549298-70549320 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1129092552 15:73166718-73166740 AGAATATTAGTTCTGGCTCATGG + Intronic
1129173911 15:73825776-73825798 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1129323830 15:74789236-74789258 AGAATGCCTGCTCTGGCTCCAGG - Intronic
1129508713 15:76104130-76104152 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1129873478 15:78956794-78956816 AGAATGTTAGCTCTGGCTCGTGG + Intergenic
1129926074 15:79365320-79365342 AGAATGTTAGGTCTGGCTTGTGG + Intronic
1129985197 15:79912723-79912745 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1130073485 15:80668888-80668910 AGAATGTAAATTCTGGCTTGTGG - Intergenic
1130432123 15:83859322-83859344 AGAATGTTAGATCTGGCCCTTGG + Intronic
1131190814 15:90315137-90315159 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1131538869 15:93259696-93259718 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1132597226 16:758643-758665 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1132702872 16:1229507-1229529 TGGATGTGAGCCCTGGCTCCCGG - Intronic
1132705454 16:1241361-1241383 TGGATGTGAGCCCTGGCTCCCGG + Intronic
1132708582 16:1256724-1256746 TGGATGTGAGCCCTGGCTCCCGG + Intronic
1133081638 16:3326003-3326025 TCAATGCAAGCTCTGTCTCCTGG + Intergenic
1133118943 16:3594697-3594719 AGAATGCAGGTCCTGGCTCCCGG - Intronic
1133302212 16:4789398-4789420 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1133346152 16:5071912-5071934 AGGATGGAAGCGCTGGCGCCGGG + Exonic
1133538406 16:6724282-6724304 TGACTGTAACCTCTGCCTCCTGG + Intronic
1134078011 16:11305659-11305681 ACACTGTAAGCTCCGCCTCCTGG - Intronic
1134646539 16:15872237-15872259 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1134752986 16:16640896-16640918 TTAATGTAACCTCTGCCTCCTGG - Intergenic
1134907345 16:17991665-17991687 AGAATGGAAACTCAGGCTCAAGG + Intergenic
1135019379 16:18950706-18950728 TCAATGTAATCTCTGCCTCCTGG - Intergenic
1135052637 16:19204940-19204962 TGAGTGTAGGCTATGGCTCCTGG - Intronic
1135672861 16:24389976-24389998 AGACTGTTAGCTCTGGCTTGTGG - Intergenic
1135717347 16:24782795-24782817 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1137314866 16:47307017-47307039 ATACTGCAAGCTCTGCCTCCCGG - Intronic
1137436321 16:48456641-48456663 ACACTGTAACCTCTGTCTCCCGG + Intergenic
1138632483 16:58309597-58309619 TTACTGTAAGCTCTGCCTCCTGG + Intronic
1138814870 16:60192272-60192294 AAAAGGTTAGCTCTGGCTCATGG + Intergenic
1139010154 16:62622169-62622191 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1139460807 16:67120985-67121007 AGAATGTAATCTCTGGGTATAGG - Intronic
1139522968 16:67495699-67495721 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1139635565 16:68256261-68256283 AGAATATAAGCTCTGGGTCTGGG - Intronic
1139755405 16:69139041-69139063 TCAATGTAACCTCTGCCTCCTGG + Intronic
1139771523 16:69280870-69280892 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1139926502 16:70490732-70490754 GGACTGCAAGCTCTGCCTCCCGG + Intronic
1140392323 16:74597939-74597961 TCACTGTAATCTCTGGCTCCCGG - Intronic
1140528413 16:75643450-75643472 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1141030845 16:80587071-80587093 AGAATGGAAGCCCTCCCTCCAGG + Intergenic
1141090093 16:81124231-81124253 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1142392197 16:89808978-89809000 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1142918221 17:3161374-3161396 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1143061061 17:4201397-4201419 AGAATGTGGGCTCTGGCACTGGG + Intronic
1143219120 17:5246800-5246822 AGAATGTTAGCTCTGGCTCCTGG - Intergenic
1143219699 17:5251238-5251260 TGACTGTAACCTCTGCCTCCCGG + Intergenic
1143409019 17:6697303-6697325 CAAATGCAGGCTCTGGCTCCTGG - Intronic
1143888659 17:10085615-10085637 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1144042476 17:11424930-11424952 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1144126442 17:12207196-12207218 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1144246857 17:13375012-13375034 AGAAAGAAAGCTCTGGCCGCTGG + Intergenic
1144860044 17:18295839-18295861 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1145076828 17:19862538-19862560 TCAATGTAACCTCTGCCTCCTGG + Intronic
1145182600 17:20766563-20766585 AGAGTGTGACCTCTGCCTCCTGG + Intergenic
1145353060 17:22105643-22105665 GGACTGCAAGCTCTGCCTCCCGG - Intergenic
1145404360 17:22572119-22572141 TCAATGCAAGCTCTGCCTCCTGG + Intergenic
1145821006 17:27835495-27835517 AGAATGTAAGCTCTGGTTTGTGG - Intronic
1145822090 17:27846590-27846612 TGACTGTAAGCTCCGCCTCCCGG + Intronic
1146301009 17:31689558-31689580 TGAATGCAACCTCTGCCTCCCGG + Intergenic
1146999247 17:37348872-37348894 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1147031329 17:37639664-37639686 ACACTGCAAGCTCTGCCTCCTGG - Intronic
1147236572 17:39062010-39062032 AGAATGTTAGCTCTGGCTCATGG - Intergenic
1147392462 17:40118833-40118855 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1147865116 17:43546536-43546558 AGAATGTAGGGGTTGGCTCCCGG + Intronic
1147875501 17:43617870-43617892 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1148038323 17:44685986-44686008 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1148716984 17:49722932-49722954 AGAATATAGGCTCAGGCTCCGGG + Intronic
1149224922 17:54458481-54458503 TAAATGTAATCTCTGCCTCCTGG - Intergenic
1149596684 17:57868425-57868447 AGGATGTAGCCTCTTGCTCCTGG - Intronic
1149744429 17:59081830-59081852 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1149973389 17:61241642-61241664 TCACTGCAAGCTCTGGCTCCTGG - Intronic
1150267027 17:63838365-63838387 AGAAGGGAAGCTATGGCTCCTGG + Intronic
1150602118 17:66660130-66660152 ACAATGTTAGCTCTGGCTTTTGG + Intronic
1151225553 17:72645442-72645464 AGGATCTAAGCTCTGGCAGCTGG + Intergenic
1151305020 17:73257768-73257790 GGTATGCAAGCACTGGCTCCGGG - Exonic
1151333725 17:73427008-73427030 ACACTGCAAGCTCTGCCTCCCGG - Intronic
1151389169 17:73774246-73774268 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1151615826 17:75210774-75210796 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1151726356 17:75887087-75887109 AGGATGCAACCTCTGCCTCCCGG - Intronic
1152208352 17:78989054-78989076 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1152406128 17:80098904-80098926 ACACTGCAACCTCTGGCTCCCGG - Intronic
1152503244 17:80726975-80726997 AGCCTGCAAGCTCCGGCTCCAGG + Intronic
1152679296 17:81657378-81657400 AGAATGTTAGCTCTGGGTTGTGG - Intronic
1152827622 17:82477427-82477449 TCACTGTAACCTCTGGCTCCCGG - Intronic
1152833338 17:82512652-82512674 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1153008456 18:516446-516468 AGAATGTTAGCTCTGGCTAATGG - Intergenic
1154305078 18:13224552-13224574 CCACTGTAAGCTCTGCCTCCAGG + Intronic
1154500524 18:14994212-14994234 TGACTGTAAGCTCCGCCTCCCGG - Intergenic
1154531592 18:15351144-15351166 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
1154998835 18:21667146-21667168 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1155005217 18:21722983-21723005 AGAAATTAAGCTCTACCTCCTGG + Intronic
1155342406 18:24826095-24826117 AGAATGTTAGCTCTGGCTCGTGG - Intergenic
1155598628 18:27517203-27517225 AGACTGTTAGCTCTGGCTCATGG - Intergenic
1155933938 18:31735407-31735429 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1156021261 18:32601956-32601978 TGACTGTAACCTCTGCCTCCTGG + Intergenic
1156896708 18:42255064-42255086 ACAATCTCAGCTCTGCCTCCCGG + Intergenic
1158370294 18:56794382-56794404 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1158841752 18:61395189-61395211 AGAATGCAGGCTCTGGAGCCAGG + Intronic
1158930793 18:62324182-62324204 TGAATGTTAGCTCTGGCTCGTGG - Intergenic
1159126974 18:64235307-64235329 TCAATGCAAGCTCTGCCTCCTGG + Intergenic
1159265198 18:66071286-66071308 TCAATGCAAGCTCTGCCTCCTGG - Intergenic
1159941093 18:74409434-74409456 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1160590251 18:79940619-79940641 AGACTGAAAGCTCTGGCTTCTGG - Intronic
1160598222 18:79992473-79992495 AGTATGTAAGCCCTGGGTCTGGG - Intronic
1161471631 19:4459766-4459788 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1161547167 19:4888415-4888437 TCAATGCAAGCTCTGTCTCCCGG - Intergenic
1162645342 19:12045570-12045592 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1162690228 19:12423704-12423726 TCAATGCAAGCTCTGCCTCCCGG - Intronic
1163072854 19:14859299-14859321 AGCATTGAAGCTCTGGCTTCTGG - Intergenic
1163653961 19:18534860-18534882 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1164176582 19:22780614-22780636 TGACTGTAACCTCTGCCTCCCGG - Intronic
1164338802 19:24364591-24364613 ACACTGCAAGCTCTGCCTCCTGG + Intergenic
1164448992 19:28343242-28343264 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1164996483 19:32723323-32723345 ACAGTGCAAGCTCTGCCTCCCGG + Intronic
1165012094 19:32856267-32856289 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1165199199 19:34131679-34131701 AAAATGTAGCCTCCGGCTCCTGG - Intergenic
1165226887 19:34361163-34361185 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1165650708 19:37486242-37486264 AGAATCTAAGCTCTTAGTCCTGG - Exonic
1165961728 19:39540205-39540227 AGAATCTATGCTCTCGCGCCCGG - Exonic
1165968028 19:39600931-39600953 TCACTGTAACCTCTGGCTCCGGG - Intergenic
1166667055 19:44686729-44686751 TGAATGCAACCTCTGCCTCCCGG - Intergenic
1166813043 19:45525621-45525643 TGACTGCAATCTCTGGCTCCCGG - Intronic
1166891408 19:45996045-45996067 AGAATGTGGGCTCTGGCGTCGGG + Intronic
1167081863 19:47281718-47281740 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1167788543 19:51655910-51655932 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1167864208 19:52310928-52310950 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1168264250 19:55213187-55213209 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1168387263 19:55974659-55974681 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1168397706 19:56063128-56063150 ACACTGCAAGCTCTGCCTCCCGG - Intergenic
1168611657 19:57805566-57805588 TCAATGCAAGCTCTGCCTCCTGG + Intronic
925109352 2:1320455-1320477 TCACTGTAAGCTCTGCCTCCCGG - Intronic
925396999 2:3541252-3541274 TCACTGTAAGCTCTGCCTCCCGG - Intronic
925421867 2:3719158-3719180 TCACTGCAAGCTCTGGCTCCCGG + Intronic
925998321 2:9309951-9309973 AGGCCGTGAGCTCTGGCTCCTGG + Intronic
926447143 2:12957007-12957029 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
929320556 2:40539066-40539088 TCACTGTAAGCTCTGCCTCCTGG + Intronic
929630320 2:43453509-43453531 AAACTCTAACCTCTGGCTCCTGG + Intronic
929689647 2:44063764-44063786 TCACTGCAAGCTCTGGCTCCTGG + Intergenic
930040652 2:47120374-47120396 AGAATGTTAGCTCTGGCTTGTGG + Intronic
930898405 2:56473464-56473486 AGAAAGTAAGGACTGACTCCAGG + Intergenic
930976222 2:57464699-57464721 TCACTGCAAGCTCTGGCTCCTGG - Intergenic
931222106 2:60297355-60297377 GGAAGGCAAGCTCTGCCTCCTGG - Intergenic
931386794 2:61805047-61805069 AGAATGTTATCTCTGGCTCATGG - Intergenic
932959624 2:76397563-76397585 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
933155141 2:78964952-78964974 GGACTGTTAGCTCTGGCTCCTGG + Intergenic
933510777 2:83238615-83238637 ATACTGTAACCTCTGCCTCCTGG - Intergenic
933551704 2:83785956-83785978 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
934742897 2:96738813-96738835 TCACTGTAAGCTCTGCCTCCCGG + Intronic
935919397 2:107994509-107994531 TCACTGTAAGCTCTGCCTCCCGG - Intronic
936442062 2:112563127-112563149 TCACTGTAAGCTCTGCCTCCCGG + Intronic
937224780 2:120362170-120362192 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
937608024 2:123825865-123825887 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
937938842 2:127269494-127269516 TCACTGTAAGCTCTGCCTCCCGG + Intronic
938256669 2:129864681-129864703 AGAATGTTAGCTCTGGCTGGTGG + Intergenic
938268274 2:129945555-129945577 AGAATCTAAGATCTGGGTGCTGG + Intergenic
938640327 2:133270992-133271014 TGAGTGCAAGCTCTGCCTCCCGG + Intronic
938847163 2:135221515-135221537 ACAATGAAAGCTCTGCCTCTTGG - Intronic
938986840 2:136584749-136584771 AGAATGAATGCTCTGGCATCAGG + Intergenic
940175397 2:150872384-150872406 AGGATGTTAGCTGTGGCTCCTGG + Intergenic
940415832 2:153418781-153418803 ACACTGTAACCTCTGCCTCCCGG - Intergenic
940724753 2:157324195-157324217 AGACTGCAACCTCTGTCTCCAGG - Intronic
940844338 2:158623670-158623692 AGGATGTCTGCTCTGCCTCCAGG - Intronic
941262484 2:163315164-163315186 TTAATGCAAGCTATGGCTCCTGG - Intergenic
941331267 2:164180292-164180314 GGAATGCAAGCTCTGGCTTTTGG - Intergenic
941903763 2:170701954-170701976 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
942051284 2:172143365-172143387 TTAATGCAAGCTCTGCCTCCTGG + Intergenic
942155258 2:173121459-173121481 TCACTGTAAGCTCTGCCTCCCGG + Intronic
942178366 2:173355755-173355777 AGAACGTAGGGTCGGGCTCCTGG + Intronic
942402016 2:175612852-175612874 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
942436916 2:175988846-175988868 TCACTGTAAGCTCTGCCTCCCGG + Intronic
942585453 2:177470627-177470649 AGTCTGTAATCTCTGCCTCCCGG - Intronic
942598172 2:177612314-177612336 AGAATGTAAGCTCTGGCTCCTGG + Intergenic
943197227 2:184769266-184769288 AAAATGTAAGTTCTGGCAACAGG + Intronic
943540921 2:189212961-189212983 TCAATGTAACCTCTGCCTCCTGG + Intergenic
944078556 2:195759245-195759267 ACATTCTAAGCCCTGGCTCCTGG + Intronic
944169656 2:196760644-196760666 AGAATGTTGGCCCTGGCTCTTGG - Intronic
944235908 2:197441259-197441281 TCAATGCAAGCTCTGCCTCCGGG - Intergenic
946471225 2:219963131-219963153 AGAATGTTAGATCTGGCCCATGG - Intergenic
946852190 2:223918554-223918576 TCACTGTAAGCTCTGCCTCCCGG - Intronic
946937646 2:224738099-224738121 AGAATGTTAGCTCTGGCTCATGG + Intergenic
947144306 2:227050840-227050862 AGAATGTAAGGTGTAGCTCAAGG - Intronic
947491309 2:230596977-230596999 AGAATGTATACTCTGGTTGCTGG - Intergenic
947941456 2:234059642-234059664 AGTATGTAAGCCCTGGATCTGGG - Intronic
948196744 2:236102341-236102363 TCAATGCAAGCTCTGCCTCCCGG - Intronic
948277699 2:236722515-236722537 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
948543290 2:238704957-238704979 AGCATGTTAGCACTGTCTCCTGG + Intergenic
948877231 2:240836239-240836261 ACACTGCAAGCTCTGCCTCCTGG - Intergenic
1169168671 20:3445884-3445906 AGAGTGCAACCTCTGCCTCCTGG - Intergenic
1169439294 20:5620666-5620688 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1169712993 20:8585278-8585300 AGCATGGTGGCTCTGGCTCCAGG - Intronic
1169773462 20:9226484-9226506 AGAATGTGAGCTCTGAAACCTGG + Intronic
1169883630 20:10373935-10373957 TCATTGTAAGCTCTGCCTCCCGG - Intergenic
1169888507 20:10428762-10428784 GTAATGTAACCTCTGCCTCCTGG - Intronic
1170297682 20:14846590-14846612 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1170467893 20:16639506-16639528 AGAATGTAAGCTCTGGCCTGTGG + Intergenic
1170725069 20:18918919-18918941 AGAATGTTAGCTCTGGCTCATGG + Intergenic
1170947143 20:20901408-20901430 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1171341752 20:24434847-24434869 TCACTGTAAGCTCTGCCTCCAGG + Intergenic
1171468095 20:25346717-25346739 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1171563297 20:26149799-26149821 GGACTGCAAGCTCTGCCTCCCGG - Intergenic
1171954992 20:31454911-31454933 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1172003671 20:31801962-31801984 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1172458287 20:35094804-35094826 AGAATGTTAGCTCTGACTTATGG - Intergenic
1172487634 20:35308114-35308136 GGTATGTGAGGTCTGGCTCCAGG + Intronic
1173206858 20:41002125-41002147 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1173505131 20:43580948-43580970 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1174210714 20:48875903-48875925 AGGATTCAAGCTCAGGCTCCTGG + Intergenic
1174578668 20:51555516-51555538 TTACTGTAAGCTCTGCCTCCCGG - Intronic
1174628474 20:51935628-51935650 TGACTGCAAGCTCTGTCTCCCGG + Intergenic
1174663290 20:52234345-52234367 AGAATGGAAGCAATGGCTACTGG - Intergenic
1175071162 20:56335161-56335183 TCAATGTAAGCTCTGCCTCCCGG + Intergenic
1175117541 20:56693701-56693723 TCACTGTAACCTCTGGCTCCTGG + Intergenic
1175156326 20:56974017-56974039 GAAATGAAAGCTCTGGCTCATGG - Intergenic
1175336783 20:58201389-58201411 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1176156517 20:63624780-63624802 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1176524740 21:7857629-7857651 AGAATGTCAGCTCTGGCTCATGG + Intergenic
1176894948 21:14366452-14366474 TCAATGTAACCTCTGTCTCCTGG + Intergenic
1177007562 21:15692745-15692767 AGAATGTTAGCTCTAGCTCCTGG + Intergenic
1177440327 21:21114893-21114915 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1177806191 21:25877177-25877199 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1178658760 21:34487642-34487664 AGAATGTCAGCTCTGGCTCATGG + Intergenic
1178738639 21:35176140-35176162 AGAATGTCACCCCTGGGTCCAGG + Intronic
1179181542 21:39049473-39049495 GGAGTGCAAGCTCTGCCTCCTGG - Intergenic
1179206897 21:39289948-39289970 TCACTGCAAGCTCTGGCTCCCGG - Intronic
1179265677 21:39800666-39800688 AGAATGGCAGCTCAGGTTCCAGG - Intronic
1180151809 21:45952117-45952139 GGAATGTTAGCTCTGGCCCATGG + Intergenic
1180217283 21:46333355-46333377 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1180501690 22:15935500-15935522 AAAATGTGAGCTCTGTCTGCAGG + Intergenic
1180924448 22:19544191-19544213 AGGATCTAAGGACTGGCTCCTGG - Intergenic
1180930119 22:19584502-19584524 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1181259770 22:21589218-21589240 TGACTGCAAGCTCTGCCTCCTGG + Intronic
1181276667 22:21691603-21691625 TCAATGCAAGCTCTGCCTCCTGG - Intronic
1181340597 22:22176579-22176601 GAAATGTTAGCTCTGGCTCATGG - Intergenic
1181969124 22:26677040-26677062 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1182655603 22:31887342-31887364 ACACTGTAACCTCTGCCTCCTGG - Intronic
1182673678 22:32019552-32019574 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1183443592 22:37838058-37838080 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1184031088 22:41895212-41895234 ACACTGCAAGCTCTGCCTCCTGG + Intronic
1184364868 22:44044263-44044285 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1185304512 22:50106774-50106796 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949120819 3:381693-381715 AGAATATTAGCTCTGGCTCATGG + Intronic
949520912 3:4853251-4853273 AGAATGTTAGCTCTGGCCTGTGG - Intronic
949553298 3:5130606-5130628 TGACTGTAACCTCTGCCTCCTGG + Intronic
949941753 3:9160033-9160055 AGAATGTAAGCTCTGGAGCCAGG + Intronic
950022913 3:9801134-9801156 TCACTGTAAGCTCTGCCTCCCGG - Intronic
950025513 3:9817347-9817369 TCACTGTAAGCTCTGCCTCCCGG - Intronic
950058241 3:10046126-10046148 TCACTGTAAGCTCTGCCTCCCGG + Intronic
950258489 3:11525627-11525649 TCACTGTAAGCTCTGCCTCCTGG + Intronic
950321546 3:12059439-12059461 AGAATGTTAACTCTGGCTCCTGG + Intronic
950379217 3:12596971-12596993 TCACTGTAAGCTCTGCCTCCCGG + Intronic
950386897 3:12667043-12667065 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
950649734 3:14399781-14399803 AGATTGTAACCTCTGGAGCCAGG + Intergenic
951256901 3:20460396-20460418 AGGCTGGAAGCTCTGCCTCCTGG + Intergenic
951369048 3:21822144-21822166 TCACTGTAAGCTCTGCCTCCTGG + Intronic
951998859 3:28761208-28761230 TGACTGTAAGCTCTGCCTCCCGG - Intergenic
952162265 3:30705821-30705843 AGAATGTTAGCTTTAGCTCATGG - Intergenic
952328223 3:32339886-32339908 TGACTGCAAGCTCTGCCTCCCGG - Intronic
952597410 3:35034885-35034907 AGACTGCAAGCTCCGCCTCCTGG - Intergenic
952935860 3:38397891-38397913 TCAATGCAAGCTCTGCCTCCCGG + Intronic
952996676 3:38889723-38889745 TCACTGCAAGCTCTGGCTCCCGG - Intronic
953092816 3:39746618-39746640 GGAATGTTAGCTCTGGCCCATGG + Intergenic
953146562 3:40281494-40281516 ACACTGCAAGCTCTGCCTCCTGG + Intergenic
953600076 3:44354094-44354116 ACAATGTAAGGTCTGTGTCCAGG + Intronic
954086309 3:48246741-48246763 ACACTGCAAGCTCTGCCTCCCGG + Intronic
954194389 3:48987796-48987818 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
954341504 3:49957904-49957926 TGACTGTAACCTCTGCCTCCCGG + Intronic
954772913 3:52989360-52989382 TCACTGCAAGCTCTGGCTCCCGG - Intronic
955159394 3:56448998-56449020 TGACTGCAAGCTCTGCCTCCTGG - Intronic
955530643 3:59869554-59869576 ATACTGTAAGCTCTGCCTCCCGG + Intronic
956074755 3:65493001-65493023 TCACTGTAAGCTCTGCCTCCTGG - Intronic
956211146 3:66802853-66802875 TCAATGCAAGCTCTGCCTCCTGG - Intergenic
956816186 3:72910588-72910610 AGAATGGAGGCTCTGTCCCCTGG - Intronic
957452167 3:80393122-80393144 AGAATGTAAAATATTGCTCCTGG - Intergenic
957908439 3:86588857-86588879 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
959334475 3:105046420-105046442 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
959805053 3:110541051-110541073 AAAATGTTAGCTCTGGCTTGTGG + Intergenic
959869335 3:111308697-111308719 AGGCTGCAAGCTCTGCCTCCTGG - Intronic
960636397 3:119789072-119789094 AGATTGTAAGCACAGGCTCCAGG + Intronic
961048186 3:123723818-123723840 AGACAGCAAGCTATGGCTCCTGG + Intronic
961056855 3:123796354-123796376 AGAATAGCAGCTCTGGCGCCAGG - Intronic
961074364 3:123967975-123967997 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
961282278 3:125773188-125773210 TGACTGCAAGCTCTGTCTCCCGG - Intergenic
961695118 3:128698804-128698826 GGAATGGCAGCTCAGGCTCCGGG - Intergenic
961746349 3:129065812-129065834 AGGATGTAAACTATTGCTCCTGG + Intergenic
962161970 3:133010331-133010353 TCAATGCAAGCTCTGCCTCCCGG - Intergenic
962504505 3:136032607-136032629 AGACTGCAAGCTCTGCCTCCCGG + Intronic
962529374 3:136264798-136264820 TGACTGCAAGCTCTGCCTCCCGG - Intronic
962787174 3:138779158-138779180 ATACTGCAAGCTCTGCCTCCTGG + Intronic
963961465 3:151313767-151313789 ACCATGTAACCTCTGCCTCCTGG - Intronic
964143448 3:153430599-153430621 TCAATGTAAGCTCCGCCTCCCGG + Intergenic
964154302 3:153565505-153565527 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
965195696 3:165591420-165591442 AGAAAGGAAGGTCTGCCTCCAGG + Intergenic
965580798 3:170265687-170265709 TGACTGCAAGCTCTGCCTCCTGG + Intronic
965797631 3:172457605-172457627 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
965843874 3:172938956-172938978 AGAATGTTAGCTCTGGCATGTGG - Intronic
965857915 3:173111333-173111355 TCACTGTAAGCTCTGCCTCCTGG - Intronic
965921209 3:173916407-173916429 AGAATATAAGCTCTAGCTTAAGG + Intronic
966297542 3:178441317-178441339 TGACTGCAAGCTCTGCCTCCCGG - Intronic
966324610 3:178740191-178740213 TCACTGTAAGCTCTGCCTCCTGG + Intronic
966513180 3:180786862-180786884 TCACTGTAAGCTCTGCCTCCCGG + Intronic
967798734 3:193629623-193629645 AGGCTGGAAGCTCTGCCTCCTGG - Intronic
968028238 3:195461149-195461171 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
968770707 4:2504623-2504645 TCACTGTAAGCTCTGCCTCCTGG + Intronic
969031609 4:4219620-4219642 TCACTGTAAGCTCTGCCTCCTGG - Intronic
969215221 4:5716434-5716456 AGAACCTTAGCTCAGGCTCCTGG + Intronic
969378812 4:6781411-6781433 AGAATGTGAACCCAGGCTCCTGG - Intronic
969406852 4:6999198-6999220 ACAATGTAAGATGTGGCTCTGGG + Exonic
969898178 4:10324246-10324268 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
970257532 4:14184187-14184209 AGAATATGAGCTCTGGATTCAGG - Intergenic
970540297 4:17071128-17071150 AGAAAGTAAGCTCTGACTTTAGG - Intergenic
970888606 4:21016371-21016393 ACACTGCAAGCTCTGCCTCCCGG + Intronic
971489748 4:27198915-27198937 ACACTGCAAGCTCTGCCTCCAGG - Intergenic
972465409 4:39351174-39351196 AGACTGCAAGCTCCGCCTCCTGG - Intronic
972491206 4:39589159-39589181 ACACTGTAACCTCTGCCTCCTGG + Intronic
972510540 4:39764959-39764981 TGACTGTAAGCTCCGCCTCCTGG + Intronic
972520448 4:39850195-39850217 TCACTGTAAGCTCTGCCTCCTGG - Intronic
972574163 4:40336549-40336571 TCACTGTAAGCTCTGCCTCCTGG + Intronic
973668497 4:53189156-53189178 AGAATGTAAGCTATTGCTGTTGG + Intronic
973978530 4:56286449-56286471 TCACTGTAAGCTCTGCCTCCCGG - Intronic
974057741 4:57001231-57001253 ACAATCTCAGCTCTGCCTCCTGG + Intronic
975125414 4:70776699-70776721 TTACTGTAAGCTCTGCCTCCCGG - Intronic
975712043 4:77170611-77170633 AAAATGTAATCTCTGGCTCATGG - Intronic
975779451 4:77822961-77822983 ACACTGCAAGCTCTGCCTCCCGG - Intergenic
975966956 4:79985273-79985295 ACACTGCAAGCTCTGCCTCCCGG - Intronic
976258588 4:83124563-83124585 TCACTGTAAGCTCTGCCTCCTGG - Intronic
976284274 4:83355976-83355998 AGAATGTTAGCTCTGGCTTATGG + Intergenic
976357909 4:84141921-84141943 CTAATGTAAACTCTGGCTCTGGG + Intergenic
976474098 4:85462728-85462750 AGAATGCCTGCTCTGGCTTCTGG - Intergenic
976591166 4:86851132-86851154 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
976676420 4:87708591-87708613 AGAAAGTAAGCTCTGCTTTCAGG - Intergenic
976908301 4:90267359-90267381 TGACTATAAGCACTGGCTCCTGG + Intronic
977076264 4:92454759-92454781 TCAATGCAAGCTCTGCCTCCTGG - Intronic
977962220 4:103098869-103098891 ATTATGTAAGAACTGGCTCCAGG + Intronic
978119112 4:105056933-105056955 TCACTGTAACCTCTGGCTCCCGG - Intergenic
978348634 4:107798205-107798227 AGGATGTAGACTCTGGCCCCAGG - Intergenic
979139984 4:117160685-117160707 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
979537544 4:121840910-121840932 TCAATGTAACCTCTGCCTCCTGG + Intronic
979550552 4:121986268-121986290 TCACTGTAAGCTCTGTCTCCCGG - Intergenic
979751022 4:124278602-124278624 AGAATGTAAGCCTTGGCCCATGG + Intergenic
979793883 4:124819867-124819889 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
979916986 4:126447574-126447596 AGAATGTAAGTACTGCCTCATGG + Intergenic
980291829 4:130854534-130854556 TCAATGCAAGCTCTGCCTCCCGG - Intergenic
980407995 4:132378997-132379019 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
981243101 4:142502276-142502298 AGAATGTTAGCTCTGGGTCCTGG - Intronic
981357652 4:143808834-143808856 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
981596142 4:146424583-146424605 TCAATGTAACCTCTGTCTCCTGG - Intronic
981816751 4:148839784-148839806 AGAATGTTAGCTCTGGCTCACGG + Intergenic
981895716 4:149796428-149796450 TGACTGTAATCCCTGGCTCCTGG + Intergenic
982109485 4:152040705-152040727 AGTATGTGGGCTCTGGATCCAGG + Intergenic
982939540 4:161532128-161532150 TCACTGTAAGCTCTGCCTCCCGG - Intronic
982967796 4:161936103-161936125 TGAATGCAATCTCTGCCTCCTGG - Intronic
984171274 4:176362393-176362415 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
984334814 4:178377138-178377160 ACACTGCAAGCTCTGCCTCCCGG - Intergenic
984782269 4:183536801-183536823 TTACTGTAAGCTCTGCCTCCCGG + Intergenic
985354507 4:189103331-189103353 AGAATGTTACCTCTGGCTCATGG - Intergenic
986089326 5:4488586-4488608 AGAATGTTAGCTTTGGCTCGTGG + Intergenic
986250068 5:6047411-6047433 AGAATGCAAGCCCAGGGTCCTGG + Intergenic
986975113 5:13384715-13384737 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
987321503 5:16774494-16774516 TCAATGCAAGCTCTGCCTCCTGG + Intronic
988036719 5:25836489-25836511 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
988078080 5:26379487-26379509 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
988185785 5:27859993-27860015 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
988601336 5:32641924-32641946 TCAATGTAACCTCTGCCTCCCGG - Intergenic
988663302 5:33297506-33297528 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
989175580 5:38521914-38521936 AGGCTGTAAGTTCTGGCACCAGG + Intronic
989792363 5:45421135-45421157 TCAATGCAAGCTCTGCCTCCTGG + Intronic
990019190 5:51104362-51104384 AAAACTAAAGCTCTGGCTCCTGG - Intergenic
990725198 5:58745321-58745343 TCAATGCAAGCTCTGCCTCCCGG - Intronic
990795204 5:59532207-59532229 ACACTGTAACCTCTGCCTCCTGG + Intronic
991413557 5:66368608-66368630 ATAATAGAGGCTCTGGCTCCTGG + Intergenic
991524667 5:67543066-67543088 AGAATGTAAGCCTAGACTCCAGG + Intergenic
991698888 5:69298849-69298871 AGACTCTAAGCTCTGTCTACAGG + Intronic
993007148 5:82441001-82441023 GGAATGTAATCTCTGGCTATTGG - Intergenic
993206032 5:84879366-84879388 AGAATGTAATCTTTTGATCCGGG + Intergenic
993283760 5:85962125-85962147 TGACTGTAACCTCTGCCTCCTGG - Intergenic
993359931 5:86962103-86962125 AGAATATGAGCTCTGTATCCAGG - Intergenic
993464848 5:88232646-88232668 TGACTGCAAGCTCTGCCTCCCGG + Intronic
993534712 5:89068312-89068334 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
993813923 5:92517088-92517110 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
994109999 5:95991578-95991600 ACACTGTAACCTCTGCCTCCAGG + Intergenic
994188737 5:96843809-96843831 AGAATGTTACCTCTGGCTCTTGG - Intronic
995597611 5:113764639-113764661 AGACTGTGAGCTCTGGCTCATGG - Intergenic
995599634 5:113781277-113781299 AGAATGTGAGCTCTGGCTCATGG + Intergenic
995600494 5:113790425-113790447 AGAATGTTAGGTCTGGGTCAGGG + Intergenic
995607124 5:113869122-113869144 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
995785606 5:115824367-115824389 ACACTGCAAGCTCTGCCTCCTGG + Intergenic
996033985 5:118737847-118737869 TGACTGCAACCTCTGGCTCCCGG + Intergenic
996678238 5:126201419-126201441 ACACTGTAACCTCTGCCTCCAGG - Intergenic
996891600 5:128427538-128427560 AGAATGTTAGCTCTGGCACGTGG - Intronic
997127121 5:131238426-131238448 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
997458953 5:134039401-134039423 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
997482545 5:134198316-134198338 TGACTGCAAGCTCTGCCTCCCGG - Intronic
997944819 5:138190688-138190710 AGAGTGCAACCTCTGCCTCCTGG - Intronic
998088721 5:139348427-139348449 TGACTGCAAGCTCTGCCTCCCGG + Intronic
998695632 5:144635472-144635494 TCACTGTAAGCTCTGTCTCCTGG - Intergenic
998958373 5:147460034-147460056 TCACTGTAAGCTCTGCCTCCTGG - Intronic
999334910 5:150707107-150707129 AGAATGTTAGCTCTGGCCGGTGG + Intergenic
999982091 5:156967433-156967455 ATAATGTAAAATCTGGCTACTGG + Intergenic
1000074360 5:157771048-157771070 GGAATGTAGGCTCAGGCCCCGGG - Intergenic
1000551285 5:162668234-162668256 AGAATGTTAGCTCTGACTGTAGG + Intergenic
1000731937 5:164845598-164845620 TCAATGCAAGCTCTGCCTCCTGG + Intergenic
1001031581 5:168266991-168267013 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1001308525 5:170593904-170593926 AGAACGTAGGCTCTAGCTTCAGG + Intronic
1001856691 5:175017686-175017708 AGAGTGCAAGTTCTGGCTCTGGG + Intergenic
1001914289 5:175546880-175546902 ACACTGCAAGCTCTGCCTCCCGG + Intergenic
1002142619 5:177152526-177152548 TCACTGCAAGCTCTGGCTCCCGG + Intronic
1002652211 5:180707285-180707307 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1003375932 6:5577874-5577896 ACACTGCAAGCTCTGCCTCCCGG + Intronic
1003686657 6:8311212-8311234 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1003841083 6:10119866-10119888 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1004077174 6:12354756-12354778 AGAGAGTAAGCTCTGCCTCTTGG - Intergenic
1004225276 6:13779149-13779171 AGAATGGTAGCTCTGGCTCGAGG + Intergenic
1004375313 6:15085947-15085969 TCAATGCAACCTCTGGCTCCCGG - Intergenic
1004400350 6:15283051-15283073 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1004446929 6:15709209-15709231 ACACTGCAACCTCTGGCTCCTGG + Intergenic
1004623128 6:17348823-17348845 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1005297662 6:24442517-24442539 TCACTGCAAGCTCTGGCTCCGGG + Intronic
1006074711 6:31524430-31524452 TCACTGTAACCTCTGGCTCCCGG + Intergenic
1006204421 6:32327864-32327886 TTACTGCAAGCTCTGGCTCCTGG + Intronic
1006384639 6:33723506-33723528 ATGATTTAAGCCCTGGCTCCTGG + Intronic
1006675890 6:35762770-35762792 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1006963796 6:37961369-37961391 TGACTGTAGTCTCTGGCTCCAGG + Intronic
1007439798 6:41848778-41848800 TCAATGCAAGCTCTGCCTCCCGG - Intronic
1007838123 6:44692405-44692427 TGACTGCAAGCTCTGCCTCCCGG - Intergenic
1008101026 6:47391675-47391697 TGACTCTAGGCTCTGGCTCCTGG - Intergenic
1008267774 6:49452405-49452427 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1008358550 6:50586441-50586463 ATAAAGTTGGCTCTGGCTCCAGG - Intergenic
1008543201 6:52563642-52563664 GGAGTGCAAGCTCTGCCTCCTGG - Intronic
1008930427 6:56933147-56933169 AGATTGTTAGCTCTGGTTTCTGG - Intronic
1008942227 6:57059514-57059536 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1009342369 6:62571923-62571945 AGAATTTAACCTCTGACCCCCGG + Intergenic
1009561087 6:65244585-65244607 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1010147157 6:72683440-72683462 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1010839116 6:80626365-80626387 TCAGTGTAAGCTCTGCCTCCTGG - Intergenic
1011273119 6:85600103-85600125 AGACTGCAACCTCTGCCTCCTGG - Intronic
1011866183 6:91831159-91831181 AAAATGTAGACTCTGTCTCCTGG - Intergenic
1012229947 6:96749726-96749748 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1012464333 6:99500857-99500879 AGAAGGTAAACTCAGGCTCCTGG - Intronic
1012568357 6:100689489-100689511 AAAATGTAAGCTCTGCCCTCAGG - Intronic
1012849541 6:104430089-104430111 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1012869595 6:104657703-104657725 TGACTGCAAGCTCTGCCTCCTGG - Intergenic
1013043435 6:106460059-106460081 AGGCTGGAAGCTCTGCCTCCCGG + Intergenic
1013305079 6:108840355-108840377 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1013699764 6:112751285-112751307 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1014005289 6:116410657-116410679 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1014028053 6:116671620-116671642 AGAATATTAGCTCTCGCTCAGGG + Intergenic
1014476225 6:121874950-121874972 TCACTGCAAGCTCTGGCTCCTGG - Intergenic
1014808250 6:125856425-125856447 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1015953119 6:138574000-138574022 ATGATGCAAGCTCTGCCTCCCGG + Intronic
1016143090 6:140637774-140637796 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1016268374 6:142258232-142258254 TCATTGTAAGCTCTGCCTCCCGG - Intergenic
1016553467 6:145308952-145308974 AGAACGTTAGCTCTGGCTCATGG - Intergenic
1016731606 6:147433325-147433347 AGAATGAAGGCTCTGCCTCTAGG - Intergenic
1017031193 6:150224030-150224052 AGAGTGTAAGGTCTGGGTCCAGG + Intronic
1017838348 6:158200647-158200669 ATACTGCAAGCTCTGCCTCCCGG - Intergenic
1017882268 6:158570305-158570327 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1018072889 6:160181712-160181734 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1019130540 6:169869782-169869804 TGACTGCAAGCTCTGCCTCCGGG - Intergenic
1019182475 6:170199326-170199348 ACATTGCAAGCTCTGCCTCCCGG - Intergenic
1019691924 7:2420046-2420068 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1019911990 7:4106376-4106398 TCACTGTAAGCTCTGCCTCCTGG + Intronic
1020075034 7:5252263-5252285 AGAATGTTAGCTCTGGCCTGTGG - Intergenic
1020365646 7:7378104-7378126 AGGATGTAAGATCTGGCGCTTGG + Intronic
1021107282 7:16652597-16652619 TGACTGTAACCTCTGTCTCCTGG + Intronic
1021547561 7:21832013-21832035 ACACTGCAAGCTCTGCCTCCCGG - Intronic
1021671918 7:23043152-23043174 AGAATGTTAGCTCTGGCTCATGG + Intergenic
1021721876 7:23512531-23512553 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1022147804 7:27563971-27563993 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1022266237 7:28757596-28757618 TCACTGCAAGCTCTGGCTCCTGG - Intronic
1022730362 7:33017106-33017128 ACATTGTAACCTCTGTCTCCTGG - Intronic
1022834305 7:34099077-34099099 AAAGTGTAAGCTCTTACTCCTGG - Intronic
1023110685 7:36807950-36807972 AGAATATTAGCTTTGGCTCGTGG + Intergenic
1023176916 7:37444585-37444607 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1023246255 7:38207542-38207564 AGCATGGGAGCTCTGGCTCCCGG - Exonic
1023285847 7:38618435-38618457 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1023409855 7:39879424-39879446 TCACTGTAAGCTCTGCCTCCGGG - Intergenic
1023429039 7:40070163-40070185 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1024052914 7:45640547-45640569 AGAATGTCAGCTCTGGCTTGTGG + Intronic
1024136619 7:46415206-46415228 AGAATGTCAGCCCTGGCTCACGG - Intergenic
1024321734 7:48077863-48077885 AGAATGTTACTTCTGGCTCATGG - Intergenic
1024709783 7:52002616-52002638 ATAATTTTAGCTCTGGCTCATGG + Intergenic
1024754525 7:52513885-52513907 AGACTGGAAGCTCTTGCTACAGG + Intergenic
1024888907 7:54179220-54179242 GGAATGTTAGCTTTGGCTCATGG + Intergenic
1025043009 7:55664163-55664185 TCACTGTAAGCTCTGCCTCCGGG + Intergenic
1025135931 7:56412691-56412713 TCACTGTAAGCTCTGCCTCCGGG + Intergenic
1025204032 7:56981281-56981303 AGAATGTTAGCTCTGGCCTGTGG + Intergenic
1025268051 7:57483816-57483838 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1025667908 7:63595653-63595675 AGAATGTTAGCTCTGGCCTGTGG - Intergenic
1025808994 7:64861715-64861737 TCACTGCAAGCTCTGGCTCCCGG - Intergenic
1025948376 7:66123027-66123049 ACACTGTAAGCTCCGCCTCCCGG + Intronic
1026014030 7:66658808-66658830 TCACTGCAAGCTCTGGCTCCCGG + Intronic
1026112452 7:67469202-67469224 TCACTGTAACCTCTGGCTCCGGG + Intergenic
1026212942 7:68323068-68323090 AGAATGTTAGCTCTGCCTCACGG + Intergenic
1026306075 7:69143061-69143083 AGGATATAAGCTCTGGTCCCTGG - Intergenic
1026492635 7:70875957-70875979 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1026521567 7:71122526-71122548 AAAACGTTAGCTCTGGCTCGTGG - Intergenic
1027208213 7:76120689-76120711 ACACTGCAAGCTCTGCCTCCTGG - Intergenic
1027570916 7:79865491-79865513 AGACTGTAAGCTCTGCCTCCTGG - Intergenic
1027635766 7:80670926-80670948 AGAATGTAAGTTCAGGTTCCTGG + Intronic
1027658683 7:80962590-80962612 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1027783767 7:82553671-82553693 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1028045335 7:86110450-86110472 AGAATGTTAGCTCTGGCTCATGG - Intergenic
1028077943 7:86537764-86537786 AGAATATTAGCTCTGGCTAGTGG + Intergenic
1028793093 7:94875709-94875731 AGAATGTTAGCTCTAGCCCCTGG - Intergenic
1028811344 7:95090731-95090753 TTACTGTAACCTCTGGCTCCTGG - Intronic
1029011320 7:97264652-97264674 TCACTGTAAGCTCTGTCTCCTGG - Intergenic
1029701179 7:102248054-102248076 AGACTGCAACCTCTGCCTCCTGG - Intronic
1029754466 7:102564764-102564786 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1029772416 7:102663847-102663869 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1029787334 7:102805904-102805926 AGAATGTTAGTTCTGGCTCATGG + Intronic
1030064061 7:105645736-105645758 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1030293431 7:107894702-107894724 AAAATCTAAGTTCTGGCTCAGGG - Intronic
1030391555 7:108934117-108934139 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1030743301 7:113135256-113135278 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1031677250 7:124625467-124625489 TCACTGAAAGCTCTGGCTCCCGG - Intergenic
1032144944 7:129370621-129370643 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1032791633 7:135246917-135246939 TCACTGCAAGCTCTGGCTCCCGG + Intronic
1032961388 7:137038986-137039008 AGAATTTAAGCTCTGAATCGAGG + Intergenic
1033344056 7:140513523-140513545 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1034189425 7:149202384-149202406 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1034655245 7:152723903-152723925 ACACTGTAATCTCTGCCTCCTGG - Intergenic
1035159275 7:156939289-156939311 AGAATGTAGACTCTGCCTCAGGG + Intergenic
1035449505 7:158967073-158967095 AGACTGTGAGGTCTGGCTCCAGG + Intergenic
1036144835 8:6245134-6245156 TCAATGCAAGCTCTGCCTCCCGG - Intergenic
1036155875 8:6341445-6341467 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1036471036 8:9053089-9053111 AGACTGCAACCTCTGCCTCCCGG + Intronic
1036802934 8:11806285-11806307 AGAAAGCAAGCTCAGGCTACTGG - Intronic
1037438703 8:18892296-18892318 TCAATGCAAGCTCTGCCTCCTGG + Intronic
1037663405 8:20945626-20945648 TGACTGTAACCTCTGTCTCCCGG + Intergenic
1037706587 8:21320759-21320781 AGAATGTTACATCTGGCTTCAGG + Intergenic
1038133462 8:24759437-24759459 ACAGTGGGAGCTCTGGCTCCAGG - Intergenic
1038161812 8:25046635-25046657 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1038212008 8:25527202-25527224 CCACTGTAAGCTCTGCCTCCCGG - Intergenic
1038369398 8:26972985-26973007 AGAATGTTAGCTCTGGCTCGTGG - Intergenic
1038510433 8:28129375-28129397 AGAGTGTAGGCTCTGGAGCCAGG - Intronic
1038704975 8:29884953-29884975 AGAATGTTAGCTCTGGCTCCTGG - Intergenic
1038712742 8:29962920-29962942 GTAATGTAAGCTCCGCCTCCCGG - Intergenic
1039000498 8:32974424-32974446 AGAGTGTTAGCTTTGGCTCATGG + Intergenic
1039168411 8:34713515-34713537 GCACTGTAAGCTCTGCCTCCTGG - Intergenic
1039255328 8:35712194-35712216 TCAATGTAACCTCTGCCTCCTGG - Intronic
1039333444 8:36563762-36563784 AGGCTGCAAGCTCTGCCTCCCGG - Intergenic
1039564747 8:38543135-38543157 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1039573428 8:38604676-38604698 AGAATGTTAGCTCTGGCCCAGGG - Intergenic
1039602487 8:38852098-38852120 AGGATGCAAGCTCTGGCACTAGG - Exonic
1039697716 8:39930152-39930174 ACACTGCAAGCTCTGCCTCCTGG - Intergenic
1039796246 8:40918057-40918079 ACAATGTTAGCTCTGGCTCCTGG + Intergenic
1041368345 8:57132647-57132669 TCAATGCAACCTCTGGCTCCTGG + Intergenic
1041621141 8:59970751-59970773 GGTATGTAAGCTCTGGGTCTGGG + Intergenic
1042241989 8:66673410-66673432 TCAATGCAAGCTCTGCCTCCCGG - Intronic
1042244921 8:66700504-66700526 TCAATGTAACCTCTGCCTCCTGG + Intronic
1042328410 8:67552696-67552718 TGCATGCAAGCTCTGCCTCCCGG - Intronic
1042819297 8:72912768-72912790 AGTATGCAGCCTCTGGCTCCAGG - Intronic
1042967974 8:74376421-74376443 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1043587937 8:81791693-81791715 TCAGTGTAAGCTCTGCCTCCTGG + Intergenic
1044461932 8:92455681-92455703 AGAATGTCAGTTGTGGCTGCTGG + Intergenic
1044655567 8:94544584-94544606 ACACTGCAAGCTCTGCCTCCCGG - Intronic
1044679690 8:94764499-94764521 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1044849422 8:96413389-96413411 ACACTGTAACCTCTGCCTCCCGG + Intergenic
1045427355 8:102080440-102080462 AGATTTTAAGTGCTGGCTCCTGG + Intronic
1046340916 8:112853298-112853320 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1047910546 8:129524053-129524075 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
1048332448 8:133479970-133479992 GGAATGCCAGCCCTGGCTCCCGG + Intronic
1050102027 9:2129341-2129363 TCAATGTAACCTCTGCCTCCCGG - Intronic
1050131327 9:2415662-2415684 GGAATGCAACCTCTGCCTCCTGG + Intergenic
1050690625 9:8222966-8222988 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1051985252 9:23078017-23078039 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1052894224 9:33732151-33732173 GCAATCTAAGCTCTGGATCCTGG - Intergenic
1053179024 9:35951911-35951933 AGAATGTTAGCCCTGGCTCGTGG + Intergenic
1053525710 9:38828290-38828312 TCACTGTAAGCTCTGCCTCCTGG - Intergenic
1053585427 9:39453170-39453192 TCAATGCAAGCTCTGCCTCCTGG + Intergenic
1054580886 9:66912056-66912078 TCAATGCAAGCTCTGCCTCCTGG - Intronic
1055543182 9:77336869-77336891 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1055571600 9:77622817-77622839 TCACTGTAAGCTCTGCCTCCTGG - Intronic
1055660679 9:78501174-78501196 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1056194015 9:84211791-84211813 GAAATGTACGCTCTGGCTCAGGG + Intergenic
1056351436 9:85752938-85752960 TCACTGTAAGCTCAGGCTCCTGG - Intergenic
1056452105 9:86726267-86726289 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1056523198 9:87419043-87419065 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1056627993 9:88269868-88269890 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1057479950 9:95437147-95437169 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1057594848 9:96406925-96406947 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1057611537 9:96547898-96547920 TCAATGCAAGCTCTGCCTCCCGG + Intronic
1058059135 9:100476467-100476489 TGACTGCAACCTCTGGCTCCTGG + Intronic
1058822445 9:108745078-108745100 TCAATGCAAGCTCTGCCTCCCGG + Intergenic
1058830591 9:108812794-108812816 AAAAGGGAAACTCTGGCTCCAGG - Intergenic
1058868234 9:109180797-109180819 AAATTGCAAGCTCTGGTTCCCGG + Intronic
1059106757 9:111518629-111518651 AGAATGTTAGCTCTGGCCCATGG + Intergenic
1059498901 9:114733751-114733773 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1060026622 9:120177373-120177395 TGTATGTCAGCACTGGCTCCTGG - Intergenic
1060382149 9:123185955-123185977 TGACTGCAAGCTCTGCCTCCCGG - Intronic
1060708494 9:125832268-125832290 TGACTGCAAGCTCTGCCTCCCGG + Intronic
1061125339 9:128671545-128671567 TCAATGTAACCTCTGCCTCCCGG + Intergenic
1061136826 9:128739425-128739447 TGACTGCAAGCTCTGCCTCCTGG - Intronic
1061148137 9:128812423-128812445 TCACTGTAACCTCTGGCTCCCGG + Intergenic
1061328624 9:129878920-129878942 ATAATCTAACCTGTGGCTCCGGG + Intronic
1061548882 9:131320858-131320880 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1061564764 9:131431203-131431225 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1061752410 9:132789218-132789240 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1185473727 X:400643-400665 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1186038534 X:5450692-5450714 TCACTGTAAGCTCTGCCTCCTGG + Intergenic
1186130587 X:6461362-6461384 AGAATGTTAGCTCTGACTCATGG - Intergenic
1186138819 X:6549210-6549232 AGACTGTATGCTCTGCCTCATGG - Intergenic
1186153771 X:6704376-6704398 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1186851222 X:13582135-13582157 TGACTGCAAGCTCTGACTCCCGG + Intronic
1188212130 X:27439440-27439462 AGAATGTTCACTCTGGCTCGTGG + Intergenic
1188410861 X:29870516-29870538 AAAGTGGAAGCTCTGGCTACAGG - Intronic
1188647312 X:32585623-32585645 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1189343947 X:40226261-40226283 TCACTGTAAGCTCTGCCTCCCGG + Intergenic
1190951836 X:55153427-55153449 TCACTGTAAGCTCTGCCTCCCGG + Intronic
1191792631 X:64987000-64987022 AAACTGCAAGCTCTGCCTCCCGG + Intronic
1193104945 X:77660488-77660510 ACACTGCAAGCTCTGCCTCCCGG - Intronic
1194339202 X:92688528-92688550 ACACTGTAACCTCTGCCTCCTGG - Intergenic
1194349692 X:92810473-92810495 TTACTGTAAGCTCTGCCTCCCGG - Intergenic
1194728557 X:97427753-97427775 TCACTGTAACCTCTGGCTCCCGG + Intronic
1195555695 X:106220076-106220098 AGAATATCAGTTCTGGTTCCAGG + Intergenic
1196122394 X:112064997-112065019 TCACTGTAAGCTCTGCCTCCCGG - Intronic
1196394967 X:115249632-115249654 TCACTGTAAGCTCTGCCTCCAGG - Intergenic
1197225837 X:123955623-123955645 TGACTGCAAGCTCTGCCTCCCGG + Intergenic
1197566079 X:128088413-128088435 AGCATGGGAGCTCTTGCTCCAGG - Intergenic
1198708879 X:139479398-139479420 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1198740669 X:139838871-139838893 TCAATGTAATCTCTGCCTCCTGG - Intronic
1199568706 X:149246081-149246103 CAACTCTAAGCTCTGGCTCCAGG - Intergenic
1199579662 X:149348477-149348499 ATAATGATAGCTCTGGCTCATGG - Intergenic
1199995163 X:153019574-153019596 AGAATGCTAGCTCTGGCTCGTGG - Intergenic
1200658014 Y:5927076-5927098 TTACTGTAAGCTCTGCCTCCCGG - Intergenic
1200783615 Y:7239112-7239134 TAACTGTAAGCTCTGCCTCCTGG + Intergenic
1201426090 Y:13852154-13852176 TGACTGCAAGCTCTGCCTCCTGG + Intergenic
1201464279 Y:14263199-14263221 AGAATGTAAATTCTGTCTCTTGG - Intergenic
1201470267 Y:14325560-14325582 TCAATGCAAGCTCTGCCTCCTGG - Intergenic
1201613094 Y:15865068-15865090 AGAAAGATAGCTCTGGCTCATGG - Intergenic
1201736972 Y:17277763-17277785 TCACTGTAAGCTCTGCCTCCCGG - Intergenic
1201973653 Y:19822353-19822375 TCAATGTAACCTCTGGCTCCAGG - Intergenic
1202104060 Y:21343196-21343218 TTACTGTAAGCTCTGCCTCCTGG - Intergenic
1202202190 Y:22365216-22365238 TAACTGTAAGCTCTGCCTCCTGG - Intronic
1202581682 Y:26388475-26388497 TCACTGTAACCTCTGGCTCCAGG + Intergenic