ID: 942605619

View in Genome Browser
Species Human (GRCh38)
Location 2:177687265-177687287
Sequence AGACAGAAGCAACAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942605619 Original CRISPR AGACAGAAGCAACAGTTGGG AGG (reversed) Intronic
901140214 1:7024185-7024207 AGACAGAGACAACAGGAGGGAGG + Intronic
909021409 1:70435378-70435400 GGAAGGAAGCAACATTTGGGAGG - Intronic
909380890 1:74997158-74997180 AGACAGAAAGAACAGTTAGGAGG - Intergenic
910562961 1:88612346-88612368 AGACATAAGCAGCTGTTTGGAGG + Intergenic
911160093 1:94675391-94675413 AGGCAGAAGCAACTGTTAGAGGG - Intergenic
911612386 1:99970931-99970953 AGATAGAATCAACAGTTGGGAGG - Intronic
912694292 1:111829351-111829373 AGAGTGAAGCAGCAGTTTGGGGG + Intronic
913042715 1:115043135-115043157 AGACATAAGCAACATAAGGGCGG + Intergenic
914689945 1:150016907-150016929 AGACAGGGGAGACAGTTGGGTGG - Intergenic
915248625 1:154572882-154572904 AGACTGAGCCAAGAGTTGGGGGG + Intronic
916745069 1:167678835-167678857 AGACAGAAACAAAGGTTGAGGGG - Intronic
916964169 1:169918122-169918144 AGACAGAACCAACAGGAGGGAGG - Intergenic
918091312 1:181297476-181297498 AGACTGAAGCATCAGAAGGGAGG + Intergenic
918966569 1:191357552-191357574 AAACAGCAGCAGCAGTTGAGTGG - Intergenic
921543361 1:216446188-216446210 AGAGAGAAGCAACAGATAGAGGG - Intergenic
923119563 1:230978266-230978288 AGTCTGAAGCAACTGTTGGAAGG - Intronic
923210913 1:231803651-231803673 AGACAGAAGCCACAGATGCCAGG + Intronic
1063507252 10:6611202-6611224 AGACAGGAGCAACGGCTGGCTGG + Intergenic
1066998162 10:42582496-42582518 AGACAAAAACAACTGTAGGGTGG + Intronic
1068055120 10:52003533-52003555 AGAAAGACACAACTGTTGGGAGG - Intronic
1071117041 10:82233677-82233699 AGGGAGAAGCAAGAGTGGGGAGG - Intronic
1073352801 10:102831794-102831816 AGACAGAAGCGCCTGTTAGGAGG - Intronic
1074021789 10:109592174-109592196 AGACAGAAATAACAATTTGGAGG + Intergenic
1074051912 10:109887984-109888006 AGACAATAGCAAGAGGTGGGGGG + Intronic
1075279761 10:121129483-121129505 AAACTGAAGCAGGAGTTGGGAGG + Intergenic
1076074653 10:127523506-127523528 CGACAGAAGCAATGGTTGGAGGG + Intergenic
1076667798 10:132102858-132102880 AGACAGATGCAGGAGTAGGGGGG + Intergenic
1076806347 10:132861089-132861111 AGACAGACGCACCAGGTGAGGGG + Intronic
1077341187 11:2027109-2027131 AGCCAGTAGCCACAGCTGGGTGG - Intergenic
1077582351 11:3424486-3424508 AGACAGAATCAACAGTTTCTGGG + Intergenic
1079270790 11:18983915-18983937 AAACAGAAGCAAAAGTTTTGTGG - Intergenic
1079652624 11:22949194-22949216 ACACTGAAACAACAGTGGGGTGG + Intergenic
1083334518 11:61914948-61914970 AGACCCCAGCAGCAGTTGGGAGG - Intronic
1083771234 11:64868800-64868822 AGACAGAAGCAACAAAAGAGGGG + Intronic
1084239262 11:67807305-67807327 AGACAGAATCAACAGTTTCTGGG + Intergenic
1084833171 11:71785541-71785563 AGACAGAATCAACAGTTTCTGGG - Intergenic
1085186000 11:74576737-74576759 AGACAGAAAGACCAGTGGGGAGG + Intronic
1085467806 11:76736083-76736105 AGACAAAAGCAACAGACGGCAGG + Intergenic
1087066319 11:94031231-94031253 AGACTGAAGCCACAGGTGGGAGG - Intronic
1089539358 11:119180736-119180758 TGACAGGAGCAACAGAAGGGAGG + Intronic
1090045772 11:123331658-123331680 AGACAGAAACAGGACTTGGGAGG - Intergenic
1202824172 11_KI270721v1_random:82298-82320 AGCCAGTAGCCACAGCTGGGTGG - Intergenic
1095203110 12:39408783-39408805 TGGCAGAAGCAATAGTTGTGGGG + Intronic
1095948413 12:47766993-47767015 AGACAGCAGCAGCAGGTGGCTGG - Intronic
1097185649 12:57194955-57194977 AGTCAGAAGCCACAGTTAGATGG - Intronic
1097671238 12:62541283-62541305 AGACATAAGAATCACTTGGGAGG + Intronic
1098033826 12:66281913-66281935 AGACAGAAGGAACATTCAGGAGG - Intergenic
1100773580 12:97950401-97950423 AGAAACAAGGAAAAGTTGGGAGG + Intergenic
1102243262 12:111338710-111338732 AGACAGGAGGATCACTTGGGAGG + Intronic
1102807809 12:115797278-115797300 AGACAAATGCAACAGTGCGGGGG + Intergenic
1103727597 12:123005799-123005821 GGTCAGAAGCCACAGTTGGAAGG + Intronic
1103991210 12:124800552-124800574 AGGCAGAAGCAAGCGTGGGGAGG + Intronic
1104767551 12:131340328-131340350 AGACAGGAGCAGCAGTTAAGGGG + Intergenic
1104812224 12:131626261-131626283 AGACAGGAGCAGCAGTTAAGGGG - Intergenic
1104858898 12:131914722-131914744 AGACAGAAGTAAATGGTGGGAGG + Intronic
1105434706 13:20366373-20366395 AGACAGCAGAAACCCTTGGGAGG + Intergenic
1107568950 13:41635855-41635877 AGGCAGAAGGAACAGCAGGGGGG + Intronic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108243611 13:48492977-48492999 AGATAGGAGCAACATTTTGGGGG - Intronic
1108495879 13:51024994-51025016 AGTCAGTAGCAACAATAGGGTGG - Intergenic
1111362229 13:87190607-87190629 AGACTGAGGGGACAGTTGGGAGG + Intergenic
1114779570 14:25522994-25523016 AGCCAGAGGAAACAGTTGGAGGG - Intergenic
1116645075 14:47517003-47517025 AAACAGAAGAAACAATTGGAAGG + Intronic
1117339578 14:54781838-54781860 AGACAGAAAGACCAGTTGGGTGG - Intronic
1118130808 14:62961359-62961381 AGACAAAAGAAACGGTTGGTGGG - Intronic
1118921533 14:70153713-70153735 GGACAGAAGCAACAGGAGAGCGG - Intronic
1119100869 14:71878923-71878945 ACACAAAAGCAAAAGTTTGGTGG - Intergenic
1121094313 14:91205343-91205365 GGAGAGGAGCAACAGTAGGGAGG - Intronic
1123058898 14:105585643-105585665 AGAGAGAATCAACAGATGAGGGG - Intergenic
1123881870 15:24684341-24684363 AGAAAGAAGGGTCAGTTGGGTGG + Intergenic
1128302295 15:66574024-66574046 AGACAAAAGGAGCAGCTGGGAGG - Intergenic
1130217727 15:81987999-81988021 AGACCGAAGCAAGAGGTGGAAGG + Intergenic
1130907637 15:88251696-88251718 GGACAGAAGCAGCAGCTGGCAGG + Intronic
1131456529 15:92586394-92586416 AGAGAGGAGGAAGAGTTGGGAGG - Intergenic
1133350931 16:5099711-5099733 AGACAGAATCAACAGTTTCTGGG + Intergenic
1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG + Intergenic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1137308471 16:47229640-47229662 AGAGAGAAGGGACAGTTGTGGGG + Intronic
1137475336 16:48803349-48803371 AGACAGAACTCACAGTTGAGTGG - Intergenic
1137603912 16:49774648-49774670 AGAAGTAAGCAACAGGTGGGTGG + Intronic
1137641240 16:50032114-50032136 AGACAGAAGCACCAGGTAGATGG - Intronic
1137685598 16:50384756-50384778 ACAAAGAGGCATCAGTTGGGTGG - Intergenic
1139428283 16:66896505-66896527 AGCAAGAAGCAAAAGTTGGAGGG - Intergenic
1140023554 16:71262476-71262498 AGAGAGAAGCAAAAGTTGAAGGG + Intergenic
1141164781 16:81653202-81653224 GGACAGAAGCATCAGTCTGGTGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141381946 16:83584889-83584911 AAACAGAAGCAAGAGATAGGGGG + Intronic
1142041234 16:87895705-87895727 AGACAGAAGCAGCAGGGCGGGGG - Intronic
1142629672 17:1216685-1216707 AGACAGCTGCAACAGCAGGGTGG - Intronic
1143396836 17:6606117-6606139 AGCCAAAAGCCTCAGTTGGGGGG + Intronic
1143895906 17:10136078-10136100 AGACGGAGACAACATTTGGGAGG - Intronic
1148508535 17:48147953-48147975 AGTCAGCAACAGCAGTTGGGAGG + Intronic
1149888399 17:60363883-60363905 AGAAAGAAGGAAGTGTTGGGGGG + Intronic
1152866759 17:82728683-82728705 AGAAAAAAGAAACAGCTGGGAGG - Intronic
1155650226 18:28132516-28132538 AGACAGAGGCAACGGGTGGGAGG + Intronic
1156202715 18:34852683-34852705 AGACAGGAGGAACACATGGGAGG - Intronic
1156345060 18:36249520-36249542 ACACAGAAGGAACAGTCTGGAGG + Intronic
1157440928 18:47711120-47711142 AGACAGAAGCAACAGCTTTTAGG - Intergenic
1157507318 18:48237421-48237443 AAAGGGAAGGAACAGTTGGGAGG + Intronic
1157814228 18:50719480-50719502 AGAAAGGAGGAACAGGTGGGAGG + Intronic
1160359447 18:78259241-78259263 AAAGTGAAGCAACAGTTGGCTGG + Intergenic
1160803419 19:980593-980615 GGACAGAAGCCACACTTTGGGGG - Intergenic
1163020224 19:14477618-14477640 AGCCAGAAGGAACAGTGGGAGGG + Intergenic
1163833594 19:19560012-19560034 AAACACACGCAAAAGTTGGGGGG - Intergenic
1164829331 19:31308689-31308711 AGACAAGAGCATCAATTGGGTGG - Intronic
1166643634 19:44514932-44514954 AGACAGGAGAATCACTTGGGAGG - Intronic
925959504 2:9002931-9002953 AGACAGAGGCAACAGTTTGTGGG - Intronic
926302101 2:11611895-11611917 AGACATAAGGAACAGCTGGTTGG + Intronic
926846810 2:17150088-17150110 TGACAGAAGCAAAAGTTGTTGGG - Intergenic
926884864 2:17587605-17587627 AGACAGGAAGACCAGTTGGGAGG + Intronic
927819415 2:26249930-26249952 ATACAGCAGCTACATTTGGGTGG + Intronic
928918861 2:36504203-36504225 AGACAGAAGAAATACTTGTGGGG - Intronic
931089272 2:58868171-58868193 AGTCATAAGCCACAGTTGGAGGG + Intergenic
933084901 2:78044043-78044065 AGGAAGCAGTAACAGTTGGGAGG + Intergenic
934577991 2:95415017-95415039 AAACATAAGCAACATTTGTGGGG - Exonic
934601447 2:95661685-95661707 AAACATAAGCAACATTTGTGGGG + Intergenic
934604448 2:95683216-95683238 AGGCACAAGCAACAGATTGGGGG + Intergenic
935883669 2:107592564-107592586 AGACAGAAGCCACAGCTGCATGG + Intergenic
936537848 2:113325447-113325469 AGGCACAAGCAACAGATTGGGGG + Intergenic
936615087 2:114040333-114040355 AGACAGATGTAAAAGTTGGAGGG - Intergenic
937230076 2:120393082-120393104 AGAAAGCAGAAACAGTTGGGTGG - Intergenic
937637053 2:124167911-124167933 AGACAGAAGGAAATGTAGGGAGG + Intronic
939031881 2:137086440-137086462 AGACAGAAGCAGGAGTTGGAGGG - Intronic
939416393 2:141904209-141904231 AGACAGGGAGAACAGTTGGGAGG + Intronic
939776356 2:146392519-146392541 AGACAGGAGCAGCAGTTAAGGGG - Intergenic
942242008 2:173971592-173971614 AGACAGAAGCATCAGAGGGGAGG - Intergenic
942343012 2:174969555-174969577 AGACCGAAGAAACAGCTAGGTGG - Intronic
942605619 2:177687265-177687287 AGACAGAAGCAACAGTTGGGAGG - Intronic
942914118 2:181282054-181282076 AAGCAGGAGCAAGAGTTGGGTGG + Intergenic
943736611 2:191363501-191363523 AGACAGAAGAAACAGGAGGCTGG - Intronic
944614827 2:201449987-201450009 AGAAAGAACCAACATTTGGCCGG - Intronic
947982606 2:234423344-234423366 AGGCAGAAGAGACAGGTGGGCGG + Intergenic
948012748 2:234662982-234663004 AGACAGAAGTAGGAGATGGGTGG - Intergenic
1169937545 20:10900501-10900523 TGACAGGAGCAACAGTAGGACGG + Intergenic
1170594253 20:17793431-17793453 GGACAGAAGCAAAGGTTGGAGGG + Intergenic
1171133520 20:22676505-22676527 AAACAGAAGCCACATGTGGGAGG + Intergenic
1173203387 20:40970457-40970479 AGACAGCAGCAGAAGCTGGGAGG + Intergenic
1173836491 20:46129280-46129302 AGACAGAGGCAGAAGTTTGGTGG + Exonic
1174215530 20:48913297-48913319 AGGCAGAAGCATCATTTGGCTGG - Intergenic
1174244984 20:49172151-49172173 ACACAAATGTAACAGTTGGGAGG + Intronic
1175783462 20:61697893-61697915 AAAGAGAAGAAACAGATGGGAGG - Intronic
1178860396 21:36284244-36284266 AGAAAGAAGGAACAGGTGGTTGG - Intronic
1182035799 22:27197318-27197340 AGACAGAAGGAAGAGCGGGGAGG - Intergenic
1183511348 22:38236977-38236999 GGTCAGAAGCAGCATTTGGGAGG - Intronic
1184742061 22:46434324-46434346 AGTCAGCAGCAGCAGCTGGGAGG + Intronic
1184925541 22:47634037-47634059 AGACAGAAGGAAAAGATGAGTGG - Intergenic
1184979307 22:48084852-48084874 ATTCAGAAGCAACAGTGTGGGGG - Intergenic
949275914 3:2280924-2280946 TGACAGAAGCAGCCGTTCGGAGG + Intronic
949303547 3:2613256-2613278 AGCGAGAAGAAACAGTTTGGGGG - Intronic
949870081 3:8580878-8580900 AGACAGAAGGAACAATCTGGGGG - Intergenic
950753145 3:15146831-15146853 AGACTGAAGGGACAGTTGGGTGG - Intergenic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
951732581 3:25826746-25826768 AGGCAGAAGCCACAGTGTGGTGG - Intergenic
952618166 3:35300843-35300865 AGAAACAACCAACAGTGGGGTGG - Intergenic
953542851 3:43837515-43837537 AGACAGAAACACCAACTGGGAGG - Intergenic
955171832 3:56573652-56573674 GGACAGAAGCATCAGGTGGTTGG + Intronic
955631285 3:60978195-60978217 AGACAGAAGCAGCTTTGGGGTGG + Intronic
956656989 3:71562159-71562181 AGGCAGAAACAACCATTGGGAGG - Intronic
957613948 3:82505325-82505347 AGTCTGAAGCTGCAGTTGGGTGG - Intergenic
958196909 3:90253306-90253328 AAAGAGAAGAAAGAGTTGGGTGG + Intergenic
959927943 3:111945822-111945844 TGGCAGAAACAACAGTTGCGGGG - Intronic
960145268 3:114194203-114194225 AGACAAAACCACCAGTTGGATGG - Intronic
961299647 3:125914619-125914641 AGACAGAATCAACAGTTTCTGGG - Intergenic
962835923 3:139188412-139188434 AGACAGAAGGATCATTTGGGAGG - Intronic
963734440 3:149003927-149003949 AGACAGAAACAAGAGTTAAGTGG - Intronic
964111036 3:153087750-153087772 AGAAGGAAGCAACAGCTGGAAGG - Intergenic
964534446 3:157704139-157704161 ACAGAGAAGCAGCAGTTTGGTGG - Intergenic
964623835 3:158740017-158740039 AGACAGCAGAAACACTGGGGTGG + Intronic
967640910 3:191861954-191861976 AGACAGCAGCAAAAGCTGGGTGG + Intergenic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
968691013 4:1990227-1990249 AGAGAGAAGCCACAGATCGGGGG - Intronic
969954113 4:10870640-10870662 AGTCAGAAATAGCAGTTGGGAGG + Intergenic
969986210 4:11213623-11213645 AGACAAAATCAACAATTGGATGG + Intergenic
970441069 4:16081955-16081977 AGACAACAGCAACAGTAAGGGGG + Intronic
971896235 4:32599216-32599238 AGAAAGAAGCAACTATTGGACGG + Intergenic
972326166 4:38017085-38017107 AGTCAGAATCCAAAGTTGGGTGG - Intronic
972438052 4:39053891-39053913 AAACAGCAGCAGCAATTGGGAGG + Intronic
975450315 4:74518044-74518066 AGACAGAAGTAAAAGGTGTGTGG - Intergenic
975900582 4:79147018-79147040 AGACAGAATAAAAAATTGGGTGG + Intergenic
976761394 4:88553099-88553121 AGACAGAACCCAGACTTGGGAGG + Intronic
977006364 4:91572606-91572628 AGCCAGAGGCCCCAGTTGGGAGG + Intronic
978350993 4:107820603-107820625 AGACAGCAGCAGCTTTTGGGGGG - Intergenic
978552823 4:109946218-109946240 AAACAGAAGGATCAGTTGAGTGG - Intronic
978630044 4:110733746-110733768 AGAAAGAAGAAACAGTGGGTGGG - Intergenic
981658807 4:147142521-147142543 AAACAGCAGCAAGATTTGGGAGG + Intergenic
982936270 4:161480732-161480754 AGACAGAATAAGCAGCTGGGAGG + Intronic
984277779 4:177630939-177630961 AAACAGAGAAAACAGTTGGGTGG - Intergenic
985080689 4:186261167-186261189 AGACATAAGCAACAATTGAAAGG - Intergenic
986058303 5:4161573-4161595 GGACACAAGAAGCAGTTGGGGGG - Intergenic
986119958 5:4825891-4825913 AGACAGCAGAAACATTTGAGAGG - Intergenic
986255173 5:6096352-6096374 AGAGAGCAGTAACAGATGGGAGG - Intergenic
987142754 5:14962237-14962259 AAAGAGAAGCCACTGTTGGGAGG - Intergenic
988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG + Intronic
989985817 5:50696778-50696800 AGAAAGAAGCAACAGATTAGGGG - Intronic
993335004 5:86646120-86646142 AAGCAGCAGCAACAGTGGGGAGG - Intergenic
994738027 5:103581394-103581416 AGACAGAAGCACCAGCTGGTAGG + Intergenic
995508544 5:112885094-112885116 AGACAGAAGCAGTACTTTGGAGG - Intronic
1000882310 5:166712425-166712447 AAAAAGAAGCACCAGGTGGGAGG - Intergenic
1002944293 6:1746158-1746180 AGTCAGAAGCCAAAGCTGGGTGG - Intronic
1003653421 6:7983817-7983839 AGACAGAAGCAACATTTCAAGGG - Intronic
1004321534 6:14635208-14635230 AAACAGAACCAACAGGTTGGGGG - Intergenic
1005182974 6:23127381-23127403 AGACAGTAGAAACAAATGGGTGG - Intergenic
1007135850 6:39521450-39521472 AAACAGTAGCAACAGTTTTGCGG - Intronic
1007839466 6:44704099-44704121 AGACAGGAGAAGCAGTTGTGGGG + Intergenic
1007917254 6:45573037-45573059 AGAAGGAAGGAAGAGTTGGGTGG - Intronic
1008623312 6:53293260-53293282 TCAGAGAAGCAGCAGTTGGGAGG + Intronic
1009510940 6:64548889-64548911 AGAGATGGGCAACAGTTGGGAGG - Intronic
1011540845 6:88426726-88426748 AGACAGAAACAAAAGTAGGGTGG + Intergenic
1011567522 6:88692662-88692684 AGACAGAAGGAAAATTTTGGGGG + Intronic
1013962635 6:115918788-115918810 ACACAGAAGCAACAGATGGAAGG + Intergenic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015617713 6:135095109-135095131 AGAGAGAAGTAAAAGGTGGGAGG + Intronic
1017497997 6:154997964-154997986 AGAAAGAAGTAAGAGTTTGGGGG + Intronic
1020186145 7:5960887-5960909 TGACAGAAGGAAGTGTTGGGGGG + Intronic
1020296770 7:6763883-6763905 TGACAGAAGGAAGCGTTGGGGGG - Intronic
1021000287 7:15321025-15321047 AGACAGAAACAACTTTTGAGAGG + Intronic
1021938881 7:25659616-25659638 AGGCAGGAGCAACATTTGAGAGG + Intergenic
1022459638 7:30593375-30593397 TGACTGAAGCAGCAGTGGGGAGG + Intergenic
1025271476 7:57523565-57523587 AGACAGTAGCTACAGTTCAGTGG - Intergenic
1026813095 7:73485515-73485537 AGTCAGAAGCATGAGGTGGGAGG + Intronic
1027707895 7:81556711-81556733 TCACAGAAGCAAGAATTGGGTGG - Intergenic
1029491528 7:100873143-100873165 AAAAAGAAGCAACAATTGGCCGG - Intronic
1030896197 7:115063372-115063394 AGCCAGAAGAACCACTTGGGAGG - Intergenic
1035015802 7:155764709-155764731 AGCCAGTAGCACCTGTTGGGTGG + Intronic
1035049111 7:155988343-155988365 AGAGAGAAGCATCAGGTGTGTGG + Intergenic
1036556376 8:9863627-9863649 AGACAGAAGTGACAGTGGGGAGG - Intergenic
1036572702 8:9995817-9995839 GAACAGAAGCAACAGCTGCGTGG + Intergenic
1037215650 8:16448217-16448239 TGACAGAAGCAAAATTTGGCAGG - Intronic
1037341098 8:17846040-17846062 ACACACAAGCATCACTTGGGTGG - Intergenic
1037808556 8:22072298-22072320 AGACACAAGCAAAGGTGGGGAGG - Intronic
1037934510 8:22906166-22906188 ACACAGAAGTACCAGGTGGGAGG + Intronic
1039825239 8:41167817-41167839 AGACAGAAGCAACTGTTCAAAGG + Intergenic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1040620988 8:49092742-49092764 AGATAGTAGCAACAGATGTGAGG - Intergenic
1041369517 8:57143755-57143777 ACACAGAGGCAACAGTTTCGAGG + Intergenic
1041373737 8:57191801-57191823 AGACAGAGGCTATAGCTGGGAGG - Intergenic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044079656 8:87867798-87867820 ACACAGGAGCACCAGGTGGGAGG + Intergenic
1044206177 8:89494160-89494182 AGACACAAGCAGCTGTTGAGAGG + Intergenic
1045928658 8:107599204-107599226 AGACACATCCAACAGTTGGTTGG + Intergenic
1049239148 8:141528109-141528131 AGAGAGAAGGAAGAGTGGGGAGG - Intergenic
1052780762 9:32780390-32780412 AGTCAGCAGCAACAGTGGGTAGG - Intergenic
1053380875 9:37649367-37649389 AGACAGAAGCACCATAAGGGTGG - Intronic
1056885261 9:90436460-90436482 AGACAGGAACAACAGTGTGGGGG - Intergenic
1057461996 9:95271449-95271471 AGACAGAAGCAAAGATTGGAGGG + Intronic
1058432964 9:104935366-104935388 AGACAGGAACAGCAGTTTGGAGG - Intergenic
1058457166 9:105148232-105148254 AGAGAGAAGGACCAGTTGAGAGG - Intergenic
1060203175 9:121664332-121664354 AGAAAGAAGAAACAGGTTGGGGG - Intronic
1060335554 9:122718585-122718607 AGACAAAACCAACAGTGGAGTGG + Intergenic
1060734105 9:126055392-126055414 AGACAGAGGCAACAGCTTTGGGG - Intergenic
1061679199 9:132234533-132234555 AGCCCGAAGCACCTGTTGGGAGG - Intronic
1062675688 9:137742251-137742273 GTGCAGAAGCAACAGTTGGAGGG - Intronic
1186029010 X:5346672-5346694 AGACAGAAGCAAGAGATTCGGGG - Intergenic
1186990316 X:15060099-15060121 AGACAGAAGCAACCTTGGGGAGG + Intergenic
1187657095 X:21488719-21488741 AGACAGGAGAAACTGTTGTGAGG + Intronic
1190088244 X:47415004-47415026 AGACACAAGCATCAGCTGGCTGG + Intergenic
1190849755 X:54227175-54227197 AGACAGTAGCAAGTGTTGGAGGG - Intronic
1191051814 X:56201637-56201659 AGACAGAAGGAAACTTTGGGAGG + Intergenic
1191879263 X:65828312-65828334 GCACAGAAGCCACAGTGGGGAGG + Intergenic
1192011456 X:67277719-67277741 AGGCAGAAACCCCAGTTGGGAGG - Intergenic
1192255614 X:69455028-69455050 AGACAGAAGCTACAGGCTGGGGG - Intergenic
1193462478 X:81807545-81807567 AGACACATTCAACAGTTGGTTGG + Intergenic
1194770355 X:97895957-97895979 AGAGAGAAGCCAAAGTTTGGAGG - Intergenic
1197244678 X:124155866-124155888 AGAAAGAAGGAACAGATAGGAGG - Intronic
1198011273 X:132557308-132557330 GGACAGAAGAACCAGTTTGGAGG + Intergenic
1199185762 X:144913038-144913060 AAACAGAAGCAACAGCAGGAAGG + Intergenic