ID: 942612410

View in Genome Browser
Species Human (GRCh38)
Location 2:177755792-177755814
Sequence GACTGGCTTGCTCTACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942612410_942612415 -4 Left 942612410 2:177755792-177755814 CCCCTTTGTAGAGCAAGCCAGTC No data
Right 942612415 2:177755811-177755833 AGTCTGCAGTGAGTACCCAAGGG No data
942612410_942612418 15 Left 942612410 2:177755792-177755814 CCCCTTTGTAGAGCAAGCCAGTC No data
Right 942612418 2:177755830-177755852 AGGGCTCCATGTGCAATGTGAGG No data
942612410_942612420 29 Left 942612410 2:177755792-177755814 CCCCTTTGTAGAGCAAGCCAGTC No data
Right 942612420 2:177755844-177755866 AATGTGAGGCTTTTCATATTTGG No data
942612410_942612414 -5 Left 942612410 2:177755792-177755814 CCCCTTTGTAGAGCAAGCCAGTC No data
Right 942612414 2:177755810-177755832 CAGTCTGCAGTGAGTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942612410 Original CRISPR GACTGGCTTGCTCTACAAAG GGG (reversed) Intronic