ID: 942616383

View in Genome Browser
Species Human (GRCh38)
Location 2:177795586-177795608
Sequence CTTCTTGGGTACCTAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942616381_942616383 -10 Left 942616381 2:177795573-177795595 CCTTCTGAAATGCCTTCTTGGGT No data
Right 942616383 2:177795586-177795608 CTTCTTGGGTACCTAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942616383 Original CRISPR CTTCTTGGGTACCTAAAGTC AGG Intronic
No off target data available for this crispr