ID: 942619687

View in Genome Browser
Species Human (GRCh38)
Location 2:177833945-177833967
Sequence CACCATTCCCCCAGTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942619687_942619690 -2 Left 942619687 2:177833945-177833967 CCACATGCACTGGGGGAATGGTG No data
Right 942619690 2:177833966-177833988 TGTGGAGCCACCAGAAATTCGGG No data
942619687_942619694 14 Left 942619687 2:177833945-177833967 CCACATGCACTGGGGGAATGGTG No data
Right 942619694 2:177833982-177834004 ATTCGGGCCTAATGCAGAGGAGG No data
942619687_942619693 11 Left 942619687 2:177833945-177833967 CCACATGCACTGGGGGAATGGTG No data
Right 942619693 2:177833979-177834001 GAAATTCGGGCCTAATGCAGAGG No data
942619687_942619696 21 Left 942619687 2:177833945-177833967 CCACATGCACTGGGGGAATGGTG No data
Right 942619696 2:177833989-177834011 CCTAATGCAGAGGAGGAGCCTGG No data
942619687_942619689 -3 Left 942619687 2:177833945-177833967 CCACATGCACTGGGGGAATGGTG No data
Right 942619689 2:177833965-177833987 GTGTGGAGCCACCAGAAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942619687 Original CRISPR CACCATTCCCCCAGTGCATG TGG (reversed) Intronic
No off target data available for this crispr