ID: 942623366

View in Genome Browser
Species Human (GRCh38)
Location 2:177872354-177872376
Sequence CTCCTCTTCCAGGGTATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942623366_942623372 -1 Left 942623366 2:177872354-177872376 CCAGTGATACCCTGGAAGAGGAG No data
Right 942623372 2:177872376-177872398 GCACACTTCATGGAGGGAGATGG No data
942623366_942623370 -8 Left 942623366 2:177872354-177872376 CCAGTGATACCCTGGAAGAGGAG No data
Right 942623370 2:177872369-177872391 AAGAGGAGCACACTTCATGGAGG No data
942623366_942623371 -7 Left 942623366 2:177872354-177872376 CCAGTGATACCCTGGAAGAGGAG No data
Right 942623371 2:177872370-177872392 AGAGGAGCACACTTCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942623366 Original CRISPR CTCCTCTTCCAGGGTATCAC TGG (reversed) Intronic
No off target data available for this crispr