ID: 942632416

View in Genome Browser
Species Human (GRCh38)
Location 2:177965248-177965270
Sequence CCTAACATCCAGAATCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632416_942632419 24 Left 942632416 2:177965248-177965270 CCTTAAAGATTCTGGATGTTAGG No data
Right 942632419 2:177965295-177965317 AATATTTTCTCCCATCCTGTAGG 0: 66
1: 2576
2: 14094
3: 18986
4: 8860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632416 Original CRISPR CCTAACATCCAGAATCTTTA AGG (reversed) Intronic
No off target data available for this crispr