ID: 942632419

View in Genome Browser
Species Human (GRCh38)
Location 2:177965295-177965317
Sequence AATATTTTCTCCCATCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44582
Summary {0: 66, 1: 2576, 2: 14094, 3: 18986, 4: 8860}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632416_942632419 24 Left 942632416 2:177965248-177965270 CCTTAAAGATTCTGGATGTTAGG No data
Right 942632419 2:177965295-177965317 AATATTTTCTCCCATCCTGTAGG 0: 66
1: 2576
2: 14094
3: 18986
4: 8860
942632418_942632419 1 Left 942632418 2:177965271-177965293 CCTTTGTCAGATGCATAATTTGC 0: 59
1: 1206
2: 2458
3: 6889
4: 19318
Right 942632419 2:177965295-177965317 AATATTTTCTCCCATCCTGTAGG 0: 66
1: 2576
2: 14094
3: 18986
4: 8860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632419 Original CRISPR AATATTTTCTCCCATCCTGT AGG Intronic
Too many off-targets to display for this crispr