ID: 942632832

View in Genome Browser
Species Human (GRCh38)
Location 2:177970549-177970571
Sequence GAAGTTAGTGAGTTTGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632829_942632832 26 Left 942632829 2:177970500-177970522 CCAACACAGAAAACTCAAGAGAA No data
Right 942632832 2:177970549-177970571 GAAGTTAGTGAGTTTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632832 Original CRISPR GAAGTTAGTGAGTTTGATTC AGG Intronic
No off target data available for this crispr