ID: 942632932

View in Genome Browser
Species Human (GRCh38)
Location 2:177971591-177971613
Sequence CAATAAAGGATGTCCCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632932_942632940 18 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632940 2:177971632-177971654 AGACAGAGAGAAGGAGATGGGGG No data
942632932_942632941 22 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data
942632932_942632938 16 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632938 2:177971630-177971652 CTAGACAGAGAGAAGGAGATGGG No data
942632932_942632939 17 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632939 2:177971631-177971653 TAGACAGAGAGAAGGAGATGGGG No data
942632932_942632936 9 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632936 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
942632932_942632942 28 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632942 2:177971642-177971664 AAGGAGATGGGGGAAGGAAGAGG No data
942632932_942632937 15 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632937 2:177971629-177971651 TCTAGACAGAGAGAAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632932 Original CRISPR CAATAAAGGATGTCCCTATT TGG (reversed) Intronic
No off target data available for this crispr