ID: 942632934

View in Genome Browser
Species Human (GRCh38)
Location 2:177971605-177971627
Sequence AGTGGATGACCAGTCAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632934_942632941 8 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data
942632934_942632945 26 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632945 2:177971654-177971676 GAAGGAAGAGGAAGAGAGAGGGG No data
942632934_942632942 14 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632942 2:177971642-177971664 AAGGAGATGGGGGAAGGAAGAGG No data
942632934_942632940 4 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632940 2:177971632-177971654 AGACAGAGAGAAGGAGATGGGGG No data
942632934_942632946 30 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632946 2:177971658-177971680 GAAGAGGAAGAGAGAGGGGATGG No data
942632934_942632943 24 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632943 2:177971652-177971674 GGGAAGGAAGAGGAAGAGAGAGG No data
942632934_942632936 -5 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632936 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
942632934_942632938 2 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632938 2:177971630-177971652 CTAGACAGAGAGAAGGAGATGGG No data
942632934_942632937 1 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632937 2:177971629-177971651 TCTAGACAGAGAGAAGGAGATGG No data
942632934_942632939 3 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632939 2:177971631-177971653 TAGACAGAGAGAAGGAGATGGGG No data
942632934_942632944 25 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632944 2:177971653-177971675 GGAAGGAAGAGGAAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632934 Original CRISPR AGTGGATGACCAGTCAATAA AGG (reversed) Intronic
No off target data available for this crispr