ID: 942632935

View in Genome Browser
Species Human (GRCh38)
Location 2:177971623-177971645
Sequence CCTTCTCTCTGTCTAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632935_942632942 -4 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632942 2:177971642-177971664 AAGGAGATGGGGGAAGGAAGAGG No data
942632935_942632943 6 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632943 2:177971652-177971674 GGGAAGGAAGAGGAAGAGAGAGG No data
942632935_942632944 7 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632944 2:177971653-177971675 GGAAGGAAGAGGAAGAGAGAGGG No data
942632935_942632948 18 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632948 2:177971664-177971686 GAAGAGAGAGGGGATGGAGGAGG No data
942632935_942632941 -10 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data
942632935_942632946 12 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632946 2:177971658-177971680 GAAGAGGAAGAGAGAGGGGATGG No data
942632935_942632945 8 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632945 2:177971654-177971676 GAAGGAAGAGGAAGAGAGAGGGG No data
942632935_942632947 15 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632947 2:177971661-177971683 GAGGAAGAGAGAGGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632935 Original CRISPR CCTTCTCTCTGTCTAGACAG TGG (reversed) Intronic
No off target data available for this crispr