ID: 942632941

View in Genome Browser
Species Human (GRCh38)
Location 2:177971636-177971658
Sequence AGAGAGAAGGAGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942632934_942632941 8 Left 942632934 2:177971605-177971627 CCTTTATTGACTGGTCATCCACT No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data
942632932_942632941 22 Left 942632932 2:177971591-177971613 CCAAATAGGGACATCCTTTATTG No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data
942632935_942632941 -10 Left 942632935 2:177971623-177971645 CCACTGTCTAGACAGAGAGAAGG No data
Right 942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942632941 Original CRISPR AGAGAGAAGGAGATGGGGGA AGG Intronic
No off target data available for this crispr