ID: 942636301

View in Genome Browser
Species Human (GRCh38)
Location 2:178010331-178010353
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942636297_942636301 30 Left 942636297 2:178010278-178010300 CCTTGTTTTCTTACTTGTAGGCA No data
Right 942636301 2:178010331-178010353 ATGCTATTGAACGTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr