ID: 942643583

View in Genome Browser
Species Human (GRCh38)
Location 2:178087039-178087061
Sequence GGATAAAGAAAATGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942643580_942643583 -7 Left 942643580 2:178087023-178087045 CCACCAATGGATGGCTGGATAAA No data
Right 942643583 2:178087039-178087061 GGATAAAGAAAATGTCAGCTGGG No data
942643581_942643583 -10 Left 942643581 2:178087026-178087048 CCAATGGATGGCTGGATAAAGAA No data
Right 942643583 2:178087039-178087061 GGATAAAGAAAATGTCAGCTGGG No data
942643579_942643583 -4 Left 942643579 2:178087020-178087042 CCTCCACCAATGGATGGCTGGAT No data
Right 942643583 2:178087039-178087061 GGATAAAGAAAATGTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942643583 Original CRISPR GGATAAAGAAAATGTCAGCT GGG Intronic
No off target data available for this crispr