ID: 942645512

View in Genome Browser
Species Human (GRCh38)
Location 2:178106644-178106666
Sequence TTTCTGCTTTGTATAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942645512_942645515 -5 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645515 2:178106662-178106684 AGAAAAATCAGATTGAGGCTGGG No data
942645512_942645514 -6 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG No data
942645512_942645517 30 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645517 2:178106697-178106719 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
942645512_942645516 0 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645516 2:178106667-178106689 AATCAGATTGAGGCTGGGCATGG No data
942645512_942645513 -10 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645513 2:178106657-178106679 AAAGCAGAAAAATCAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942645512 Original CRISPR TTTCTGCTTTGTATAAAAAT TGG (reversed) Intronic
No off target data available for this crispr