ID: 942645514 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:178106661-178106683 |
| Sequence | CAGAAAAATCAGATTGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942645512_942645514 | -6 | Left | 942645512 | 2:178106644-178106666 | CCAATTTTTATACAAAGCAGAAA | No data | ||
| Right | 942645514 | 2:178106661-178106683 | CAGAAAAATCAGATTGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942645514 | Original CRISPR | CAGAAAAATCAGATTGAGGC TGG | Intronic | ||
| No off target data available for this crispr | |||||