ID: 942645514

View in Genome Browser
Species Human (GRCh38)
Location 2:178106661-178106683
Sequence CAGAAAAATCAGATTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942645512_942645514 -6 Left 942645512 2:178106644-178106666 CCAATTTTTATACAAAGCAGAAA No data
Right 942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942645514 Original CRISPR CAGAAAAATCAGATTGAGGC TGG Intronic
No off target data available for this crispr