ID: 942647046

View in Genome Browser
Species Human (GRCh38)
Location 2:178123607-178123629
Sequence CAATGAAGGAAACACCTATT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942647046_942647049 16 Left 942647046 2:178123607-178123629 CCGAATAGGTGTTTCCTTCATTG 0: 1
1: 0
2: 0
3: 21
4: 167
Right 942647049 2:178123646-178123668 AACAGAGTAAGTACCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942647046 Original CRISPR CAATGAAGGAAACACCTATT CGG (reversed) Exonic
901491650 1:9599556-9599578 AAATGATGGAAACAGTTATTTGG - Intronic
901726397 1:11246090-11246112 CAATGAAGCAAATACTTATACGG + Intronic
902127021 1:14223195-14223217 CAAAGCAAGAAACACCTTTTGGG + Intergenic
905761519 1:40562190-40562212 CAATGAAACAAACACCTACTTGG - Intergenic
907874756 1:58474722-58474744 CAACGAGGGAAACAATTATTTGG - Intronic
908311511 1:62889202-62889224 CAATGATGAAAAGACATATTAGG - Intergenic
908688236 1:66747565-66747587 CAAAGAAGGAAACATTGATTAGG - Exonic
909184998 1:72476312-72476334 CATTGAAGGAAAAACATTTTGGG - Intergenic
909875133 1:80792947-80792969 CAATGAAGCAAACAGGTACTAGG - Intergenic
909918362 1:81349042-81349064 CAATGAAGGAAATATATATATGG - Intronic
911628825 1:100159039-100159061 CAATGAAAGAAAAGCCTCTTTGG - Intronic
912078209 1:105904961-105904983 CTATGCAGGAAACAATTATTCGG + Intergenic
916919165 1:169444477-169444499 CATTGTAGGAAACAACCATTAGG - Intronic
919493574 1:198236339-198236361 CAATGAAGGAAACTGTTACTAGG - Intronic
921831503 1:219732777-219732799 AAATGAAGGATACACATATGAGG - Intronic
923355389 1:233150015-233150037 CAATGAAAGAAACACATAGGGGG - Intronic
1064165344 10:12980818-12980840 CAATGAAGCAAACAGCTACAGGG + Intronic
1068683962 10:59849924-59849946 CTATTAAGGAAATACATATTGGG + Intronic
1069402191 10:68061101-68061123 CAATGTAGGCAAGAGCTATTGGG - Intronic
1071008332 10:80909586-80909608 CCATGATCCAAACACCTATTAGG + Intergenic
1072320585 10:94245921-94245943 TAAGGAAAGAAACACCAATTTGG - Intronic
1072486396 10:95860310-95860332 CCAGGAAGGAAACAGCTCTTGGG + Intronic
1076336106 10:129707372-129707394 CGATGAAGGAAACACAGAGTAGG + Intronic
1078888948 11:15536337-15536359 CAATGTAGGAAACAACTACCAGG + Intergenic
1080309652 11:30874785-30874807 CAATGTAGGAAACTGATATTAGG - Intronic
1081309302 11:41551299-41551321 GATTGAAGAAAACACCTATGGGG + Intergenic
1085420062 11:76349413-76349435 CAATGAAGGAAACACAAAGCTGG - Intergenic
1088614245 11:111607918-111607940 CAATTAAGAAAACAATTATTTGG + Intronic
1095233384 12:39768605-39768627 CAAAGAAGGAAACAGCTGGTTGG + Intronic
1095638959 12:44465277-44465299 AAATGAAGGAACCAACCATTAGG + Intergenic
1096714783 12:53484624-53484646 CATTGAAGGAACCACATTTTGGG + Intronic
1097955851 12:65484415-65484437 CAATGGAGGAAACGCCTCTGCGG - Intronic
1098192242 12:67961875-67961897 CGATGAAGGAAACACATAGATGG - Intergenic
1099326165 12:81217253-81217275 CTATGAAGGAAACACCTGCTGGG + Intronic
1102684302 12:114712526-114712548 CAATAAGGGAAACACCTTTTGGG + Intergenic
1104207437 12:126653326-126653348 CAATGAGAAAAACACATATTTGG - Intergenic
1104221204 12:126786648-126786670 CACTGCAGGGAACACATATTGGG + Intergenic
1105308886 13:19188984-19189006 CAATAAAGGGAACTCCAATTTGG + Intergenic
1105528711 13:21199167-21199189 CAATAAAGGGAACTCCAATTTGG - Intergenic
1105637556 13:22229995-22230017 TAATGAAGTAAACTGCTATTGGG + Intergenic
1105776872 13:23670456-23670478 GAATGAAGGAAAAACAAATTAGG + Intronic
1107098602 13:36562937-36562959 GAAGGAAGGAAAAACCTTTTAGG - Intergenic
1108271498 13:48764507-48764529 CCATGAAAGAAGCATCTATTTGG + Intergenic
1108288365 13:48931922-48931944 AAATGAAAGAAACATTTATTTGG - Intergenic
1109917039 13:69002721-69002743 CAATGAAGGCAATACCATTTTGG + Intergenic
1110680712 13:78308918-78308940 CAATGAAGTAAATGCGTATTTGG - Intergenic
1110752670 13:79133361-79133383 CAATGAAGAAAAAGCATATTAGG + Intergenic
1111181440 13:84672183-84672205 TAATAAAGTGAACACCTATTGGG + Intergenic
1112465584 13:99641996-99642018 CAATGCAGAAAACACATATGGGG + Intronic
1113968331 13:114167476-114167498 CAATGAAGGATTCACGAATTGGG + Intergenic
1115050579 14:29056728-29056750 CAATGGAGGAAAAAGCTACTGGG + Intergenic
1118081881 14:62370624-62370646 CAAAGATGTAAACACCTATCAGG - Intergenic
1121183250 14:91945428-91945450 CATGGAAAGAAATACCTATTGGG + Intronic
1124451847 15:29800673-29800695 CAATGGAGGAAACAGCTATATGG - Exonic
1124453926 15:29822843-29822865 CAGTGAAGGAAACAACTGTCGGG - Intronic
1124827222 15:33109655-33109677 CAAAGAAGGAAACAAATACTGGG + Intronic
1125112370 15:36047987-36048009 CAATGGAAGGAACACATATTGGG - Intergenic
1127180730 15:56414417-56414439 CAAAGAAGGAAACAGACATTGGG - Intronic
1127448229 15:59088033-59088055 AAGTGAAGGAAACCCCTATTTGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1140763556 16:78133989-78134011 CATTGAAGAAAACACATCTTAGG - Intronic
1141064406 16:80902250-80902272 CATTAAAGTAAACATCTATTAGG - Intergenic
1143068919 17:4273744-4273766 CAGAAAAGGAAACACCTATTAGG + Intronic
1147140428 17:38457894-38457916 GAAAGAAGGAAAAAGCTATTGGG + Intronic
1147270892 17:39270127-39270149 CATTGAAGGAAACACATGTCTGG - Intronic
1147685783 17:42286274-42286296 CAATGAAAGACACAGATATTCGG + Intergenic
1149924038 17:60685089-60685111 AAATAAAGCAAACACCTACTAGG - Intronic
1149957296 17:61066299-61066321 TAATGAAGGAAAAGTCTATTTGG - Intronic
1157512924 18:48291398-48291420 CAAGGGAGGAAACACCTTTATGG - Intronic
1157701481 18:49763766-49763788 CAATGAAAGAGACACCTGTGTGG + Intergenic
1162830762 19:13282853-13282875 CTTTGAAAGAAACAACTATTTGG - Intronic
1165573454 19:36794572-36794594 AAATAGAGGAAAAACCTATTCGG + Intergenic
925635475 2:5937788-5937810 AAATGAAGGAAAAACAGATTGGG - Intergenic
926839197 2:17059679-17059701 GCATGAAGGGAACACCTGTTAGG - Intergenic
927010309 2:18897238-18897260 CAATGACAGAAACTCCTATGAGG - Intergenic
932308377 2:70719966-70719988 AAATCAAGGAAACAGCTATTGGG + Intronic
932795563 2:74692367-74692389 CAAGGGAGGAAACACATATGGGG + Intergenic
933349992 2:81141431-81141453 CAAAGAGGGAAAGACCTCTTTGG - Intergenic
934129268 2:88931836-88931858 TAGTGATGGAAACACCTATTTGG - Intergenic
934169706 2:89330301-89330323 TGATGATGGAAACACCTATTTGG - Intergenic
934197586 2:89852284-89852306 TGATGATGGAAACACCTATTTGG + Intergenic
937681647 2:124650814-124650836 CAATGAACAAATCTCCTATTTGG + Intronic
940831676 2:158473622-158473644 CAAAGAAGGAAACAACCCTTGGG + Intronic
941171026 2:162136625-162136647 CAATGAAGCAAACACATTTGTGG - Intergenic
941952220 2:171167337-171167359 CAAAGAAGGAAACAAAAATTTGG - Intronic
942647046 2:178123607-178123629 CAATGAAGGAAACACCTATTCGG - Exonic
943661288 2:190562125-190562147 CAAAGAGGGAAAAAACTATTTGG - Intergenic
944137689 2:196417007-196417029 CGATGAAGGAAATTCCTATTAGG + Intronic
945175973 2:207043777-207043799 CAAGGAAGCAAAAATCTATTTGG + Intergenic
948741627 2:240051237-240051259 CACTGAATAAAACACATATTAGG - Intergenic
1169008729 20:2231858-2231880 CAATGAAGGAGAAAGCTATGTGG + Intergenic
1170344157 20:15364774-15364796 CAATGAAGGGAGCCCCTACTGGG + Intronic
1170779468 20:19411246-19411268 CAAGGTGGGTAACACCTATTTGG - Intronic
1170890889 20:20374433-20374455 CAATGATGGAAACATCTCATGGG + Intergenic
1171795098 20:29560304-29560326 CAAGGACGGAGACACTTATTTGG + Intergenic
1171853356 20:30323961-30323983 CAAGGACGGAGACACTTATTTGG - Intergenic
1173876097 20:46372770-46372792 TAATGAAGGAAAAACCTGTAGGG + Intronic
1174671446 20:52311493-52311515 CTATGGATGAAACACCTTTTTGG - Intergenic
1177097007 21:16848825-16848847 CAATGAAGAAAACTCCTTGTAGG + Intergenic
1177575305 21:22947159-22947181 GATTGAAGGAAACACGTTTTTGG - Intergenic
1179142944 21:38743429-38743451 CAGAGAAGAAAACAACTATTGGG + Intergenic
1179607562 21:42527196-42527218 CCATGAAGGCACCACCTGTTGGG + Intronic
1182904699 22:33925215-33925237 CAAAGAAGAAATCACCTGTTAGG + Intergenic
1183127720 22:35800892-35800914 AAATGAAGGACACACGAATTTGG + Intronic
1184917535 22:47580867-47580889 TACTGAAGGAAACAACTCTTAGG - Intergenic
1185299996 22:50074552-50074574 CAGTGGGGGAAACACCTCTTTGG - Intronic
950105181 3:10384138-10384160 CAAAGATGGAAGCACCTAGTAGG - Intronic
952267937 3:31804510-31804532 CAATGAAGGAGACCCGTATTAGG + Intronic
962294280 3:134167077-134167099 CTATAAAGGAAACAAATATTAGG + Intronic
964365057 3:155941626-155941648 CAATGAAAGAAGCATCCATTGGG - Exonic
967315183 3:188145346-188145368 CAAAAAAGCAAACACATATTTGG - Intergenic
968043192 3:195605407-195605429 AATTGAAGGAAACAACTCTTGGG - Intergenic
971586270 4:28408781-28408803 CATGGAAAGGAACACCTATTGGG + Intergenic
971692887 4:29860166-29860188 TATTGAAGGAAACAACTCTTAGG - Intergenic
971986124 4:33827140-33827162 CAAAGAAGGAAACACAACTTTGG - Intergenic
972247724 4:37262961-37262983 AAATGAAGGCAACAACCATTTGG + Intronic
974142682 4:57908054-57908076 GTATCAAGGAAAAACCTATTGGG + Intergenic
974571136 4:63650185-63650207 CAATGAAGGAAACAGAGAGTGGG - Intergenic
975197659 4:71544361-71544383 CAGTGAAAGAAACACATATGAGG + Intronic
975317185 4:72967975-72967997 CAATAAAGGCAACAGCAATTTGG + Intergenic
978155033 4:105479996-105480018 AAATGAAGAAAATACATATTTGG + Intergenic
980053535 4:128060497-128060519 CCAGGAAGAAAAAACCTATTGGG + Intergenic
980699306 4:136403216-136403238 CAATGAAGAAATCACCTTTTAGG - Intergenic
981219385 4:142213788-142213810 TAATGAAGGAAATACCCAGTGGG - Intronic
983782912 4:171695395-171695417 CATTGGAGGAAATAACTATTGGG - Intergenic
984170737 4:176356413-176356435 TATTGAAGGAAACAACTCTTAGG + Intergenic
990892315 5:60662601-60662623 CACTGAAAGAAAGCCCTATTAGG - Intronic
993169986 5:84406836-84406858 CAATGAAGGAAAGCTCTATGAGG - Intergenic
993767341 5:91877780-91877802 AAATGAAGAAAATACCTACTAGG - Intergenic
994173830 5:96688473-96688495 CTAAGAAGGAAACACCTGTATGG + Intronic
995891205 5:116953971-116953993 CACTGAAGGAAACAGCTTTCAGG - Intergenic
996649863 5:125862030-125862052 CAATAAAGGAAATACAAATTTGG - Intergenic
996769351 5:127069553-127069575 CAATGAATGAAACATCTTTTAGG - Intronic
996898522 5:128516063-128516085 CGATCAAGTAATCACCTATTTGG + Intronic
997220488 5:132158146-132158168 AAATGGAAGATACACCTATTGGG + Intergenic
998427017 5:142037285-142037307 CAATGAAGGATTCACGAATTGGG + Intergenic
998576275 5:143320794-143320816 CAAAGAAGGATACAGCTGTTAGG - Intronic
1000184511 5:158846172-158846194 CAATGCAGGAAACAGCTGTGTGG + Intronic
1000518793 5:162274206-162274228 CAATCAAGCAAATTCCTATTAGG - Intergenic
1000864689 5:166498823-166498845 CAAGGAAGGAGACAGCTATAAGG - Intergenic
1001767022 5:174257816-174257838 CATTGAGGGAATAACCTATTTGG - Intergenic
1003670502 6:8153596-8153618 CAATGAGGGAAATAGCCATTAGG + Intergenic
1003807451 6:9741440-9741462 TAATGTAGGAAACACCACTTTGG - Intronic
1005876239 6:30011831-30011853 CAATGGAGGAGACATCTATGAGG + Intergenic
1010584213 6:77638312-77638334 CACTGAAAGAAACCCCTATGTGG - Intergenic
1014259261 6:119197377-119197399 CAAGTAAGTAAACACCTACTAGG + Intronic
1015642302 6:135348325-135348347 AAATGAAGGAAACAATTATTTGG - Intronic
1016578313 6:145597376-145597398 CAATGAAGCAATCTTCTATTGGG - Intronic
1018864996 6:167739452-167739474 CAGTGAAGGAAAGACCTCTCTGG - Intergenic
1020460570 7:8425468-8425490 CCATCAAGTAAACATCTATTGGG + Intergenic
1021452099 7:20792314-20792336 AAATGAAGGAAACACATGTAGGG + Intergenic
1022311077 7:29196099-29196121 CAAAGGAAGAAACACCTTTTTGG + Intronic
1022657399 7:32331935-32331957 CAATGTGGGAAAGACCTTTTAGG - Intergenic
1026474391 7:70722069-70722091 CAATGAAGACCACACCTTTTTGG + Intronic
1027992789 7:85384295-85384317 CAATGAAGGCAAAAACAATTCGG + Intergenic
1028013892 7:85683038-85683060 TAATGAAAGAAACACATCTTAGG - Intergenic
1032984495 7:137322204-137322226 CACAGGAGTAAACACCTATTAGG - Intronic
1035846381 8:2869575-2869597 GAAAGAAGAAAACACCAATTTGG - Intergenic
1040991153 8:53351679-53351701 TATTGAAGGAAACAACTCTTAGG + Intergenic
1041384405 8:57283969-57283991 CAATGAAAGAGTGACCTATTTGG - Intergenic
1042424838 8:68635496-68635518 AAATGAAGCAATCACCTTTTGGG - Intronic
1044974694 8:97652471-97652493 CTATGAAGGAAACATCTAAGGGG - Intronic
1046696282 8:117343510-117343532 TAATGATGGAAAGAACTATTAGG + Intergenic
1047417913 8:124680776-124680798 GAATGAAGGACACTCCTCTTAGG + Intronic
1050677101 9:8068610-8068632 AAATGTAGGAAACACCATTTTGG - Intergenic
1050818661 9:9849154-9849176 CAGTAAAGGAAACAGTTATTGGG + Intronic
1051009023 9:12387411-12387433 TAATAAAGGAAATACATATTGGG - Intergenic
1052418065 9:28203323-28203345 CAAGGGAGGAAGCACCTATTTGG + Intronic
1052763218 9:32613985-32614007 CAATAAAGGAAACACATTTTGGG - Intergenic
1053514593 9:38719922-38719944 CAATAAAGGACACACATATAAGG + Intergenic
1054805000 9:69389154-69389176 CAATGAAGCCAACACCTAAAAGG - Intronic
1055345431 9:75331469-75331491 CAACCAAGGAAACACCTTTTTGG + Intergenic
1055540942 9:77304451-77304473 CAATGAAGGACACAAATAATAGG + Intronic
1055731113 9:79280015-79280037 CAAAGAAGAAAACTTCTATTTGG + Intergenic
1059480895 9:114588612-114588634 CAGTGAAGGAAGCAGGTATTGGG + Intronic
1061289005 9:129640386-129640408 CAACTAAGGAAACTCCCATTGGG - Intronic
1061804927 9:133132553-133132575 CACTGTAGGAAACACCTTCTCGG - Intronic
1185971243 X:4667251-4667273 AAATGATAGAAACACCTTTTTGG + Intergenic
1186955267 X:14674890-14674912 CAATGAAGAAAAGACCCAATTGG - Intronic
1187649647 X:21388404-21388426 GAGTGAAGGAAACAGCTTTTTGG + Intronic
1192458388 X:71296683-71296705 TTAAGAAGGAAACACCTAATAGG - Intronic
1193973029 X:88081056-88081078 CAATTAATCAAATACCTATTAGG + Intergenic
1197481112 X:126987135-126987157 TATTGAAGGAAACAACTCTTAGG - Intergenic
1198166822 X:134065941-134065963 CCATGAAGGCAAAACATATTTGG - Intergenic
1199166416 X:144680697-144680719 CATTGAAGGAAACAACTCTTAGG - Intergenic
1199507876 X:148586349-148586371 CCATGATGGAAATACATATTAGG + Intronic
1200012799 X:153132563-153132585 CTTTGAAGGAAACACCTGTTTGG - Intergenic
1200026801 X:153267354-153267376 CTTTGAAGGAAACACCTGTTTGG + Intergenic
1200167171 X:154044698-154044720 CCATGAAGGCAACACATTTTGGG + Intronic