ID: 942649553

View in Genome Browser
Species Human (GRCh38)
Location 2:178152270-178152292
Sequence TAGTTGCAACAGAAGTTGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942649551_942649553 8 Left 942649551 2:178152239-178152261 CCTGTTTTTGTGCTGCAGTAGTG No data
Right 942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG No data
942649550_942649553 29 Left 942649550 2:178152218-178152240 CCATACTCTTTTGTTTACATGCC No data
Right 942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942649553 Original CRISPR TAGTTGCAACAGAAGTTGTA CGG Intergenic
No off target data available for this crispr