ID: 942650096

View in Genome Browser
Species Human (GRCh38)
Location 2:178157588-178157610
Sequence AGCCCTGTTGCCCCAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942650092_942650096 11 Left 942650092 2:178157554-178157576 CCAATCACTGGTCAATGCAGAGG No data
Right 942650096 2:178157588-178157610 AGCCCTGTTGCCCCAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942650096 Original CRISPR AGCCCTGTTGCCCCAATTCA AGG Intergenic
No off target data available for this crispr