ID: 942650375

View in Genome Browser
Species Human (GRCh38)
Location 2:178160860-178160882
Sequence CTAAGCTATGAGGCTAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942650375_942650377 -7 Left 942650375 2:178160860-178160882 CCAAACTTAGCCTCATAGCTTAG No data
Right 942650377 2:178160876-178160898 AGCTTAGCAACCAAACAGAAAGG No data
942650375_942650379 9 Left 942650375 2:178160860-178160882 CCAAACTTAGCCTCATAGCTTAG No data
Right 942650379 2:178160892-178160914 AGAAAGGAAGTGCTTCCTCCTGG No data
942650375_942650380 20 Left 942650375 2:178160860-178160882 CCAAACTTAGCCTCATAGCTTAG No data
Right 942650380 2:178160903-178160925 GCTTCCTCCTGGCCCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942650375 Original CRISPR CTAAGCTATGAGGCTAAGTT TGG (reversed) Intergenic
No off target data available for this crispr