ID: 942650377

View in Genome Browser
Species Human (GRCh38)
Location 2:178160876-178160898
Sequence AGCTTAGCAACCAAACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942650375_942650377 -7 Left 942650375 2:178160860-178160882 CCAAACTTAGCCTCATAGCTTAG No data
Right 942650377 2:178160876-178160898 AGCTTAGCAACCAAACAGAAAGG No data
942650374_942650377 5 Left 942650374 2:178160848-178160870 CCTGTGATGGATCCAAACTTAGC No data
Right 942650377 2:178160876-178160898 AGCTTAGCAACCAAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942650377 Original CRISPR AGCTTAGCAACCAAACAGAA AGG Intergenic
No off target data available for this crispr