ID: 942650379

View in Genome Browser
Species Human (GRCh38)
Location 2:178160892-178160914
Sequence AGAAAGGAAGTGCTTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942650374_942650379 21 Left 942650374 2:178160848-178160870 CCTGTGATGGATCCAAACTTAGC No data
Right 942650379 2:178160892-178160914 AGAAAGGAAGTGCTTCCTCCTGG No data
942650376_942650379 -1 Left 942650376 2:178160870-178160892 CCTCATAGCTTAGCAACCAAACA No data
Right 942650379 2:178160892-178160914 AGAAAGGAAGTGCTTCCTCCTGG No data
942650375_942650379 9 Left 942650375 2:178160860-178160882 CCAAACTTAGCCTCATAGCTTAG No data
Right 942650379 2:178160892-178160914 AGAAAGGAAGTGCTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942650379 Original CRISPR AGAAAGGAAGTGCTTCCTCC TGG Intergenic
No off target data available for this crispr