ID: 942653577

View in Genome Browser
Species Human (GRCh38)
Location 2:178193730-178193752
Sequence CACCGAACGCAGGCCGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942653573_942653577 -5 Left 942653573 2:178193712-178193734 CCTTTAGATTAATCTGCACACCG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653569_942653577 12 Left 942653569 2:178193695-178193717 CCCTCCCAGCAAATTTGCCTTTA 0: 1
1: 0
2: 2
3: 14
4: 227
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653568_942653577 16 Left 942653568 2:178193691-178193713 CCGTCCCTCCCAGCAAATTTGCC 0: 1
1: 0
2: 1
3: 28
4: 282
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653571_942653577 8 Left 942653571 2:178193699-178193721 CCCAGCAAATTTGCCTTTAGATT 0: 1
1: 0
2: 4
3: 26
4: 272
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653570_942653577 11 Left 942653570 2:178193696-178193718 CCTCCCAGCAAATTTGCCTTTAG 0: 1
1: 0
2: 0
3: 7
4: 163
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653572_942653577 7 Left 942653572 2:178193700-178193722 CCAGCAAATTTGCCTTTAGATTA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653566_942653577 18 Left 942653566 2:178193689-178193711 CCCCGTCCCTCCCAGCAAATTTG 0: 1
1: 1
2: 0
3: 11
4: 249
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126
942653567_942653577 17 Left 942653567 2:178193690-178193712 CCCGTCCCTCCCAGCAAATTTGC 0: 1
1: 0
2: 1
3: 11
4: 133
Right 942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942653577 Original CRISPR CACCGAACGCAGGCCGGGAG TGG Intergenic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
901826969 1:11868415-11868437 GACTCAACGCAGGCCGGGTGTGG - Intergenic
903046424 1:20567443-20567465 CACAGAAAGGAGGCCGGGCGCGG - Intergenic
903111219 1:21135891-21135913 CAAAGAACACAGGCCGGGCGCGG + Intronic
903850744 1:26304392-26304414 AACATAAAGCAGGCCGGGAGCGG + Intronic
905097075 1:35482112-35482134 AACAGAAAGCAGGCCGGGCGTGG - Intronic
906590284 1:47018561-47018583 CACCGAATGCAGCGCTGGAGTGG + Intergenic
912382487 1:109254954-109254976 CACCAAAGGCAGGCTGGGTGTGG - Intronic
917839425 1:178965424-178965446 CACCGAACACAGGTCAGTAGAGG + Intergenic
918311743 1:183290041-183290063 CACAGAAACCAGGCAGGGAGAGG - Intronic
1067337210 10:45375138-45375160 AACAGAACCCAGGCCAGGAGAGG + Intronic
1073740400 10:106399819-106399841 AACCTACCACAGGCCGGGAGCGG + Intergenic
1075159629 10:120011869-120011891 CACCGCACGCTGGCCGGGCAAGG + Intergenic
1075891362 10:125954011-125954033 CACCGAACGAAGGAGGGAAGGGG + Intronic
1077942137 11:6854570-6854592 CACCGAATGCAGTGCTGGAGTGG - Intergenic
1081492485 11:43579211-43579233 CTGCGAGCGCCGGCCGGGAGGGG - Intronic
1083677207 11:64332725-64332747 ATTCGAACCCAGGCCGGGAGTGG + Intergenic
1083867911 11:65467988-65468010 CACCCATCTCAGGCCGGGTGTGG + Intergenic
1084521484 11:69665862-69665884 AACAAAAAGCAGGCCGGGAGTGG + Exonic
1085399019 11:76224504-76224526 CACCAAATGCAGGACAGGAGAGG - Intergenic
1090758480 11:129815711-129815733 CCCCGCACGCTGGCCGGGACCGG + Intergenic
1091660160 12:2377250-2377272 AACAGAACGGGGGCCGGGAGAGG - Intronic
1091820543 12:3472415-3472437 CACTGAAGGCAGGACAGGAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1102373140 12:112399397-112399419 TACCGAATGTAGGCCGGGTGCGG + Intergenic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1111577921 13:90183051-90183073 CAAGGAACTCAGGCCGGGCGCGG + Intergenic
1117865337 14:60142689-60142711 TACCATACACAGGCCGGGAGCGG + Exonic
1122670799 14:103370586-103370608 AAAAGAATGCAGGCCGGGAGTGG - Intergenic
1124338885 15:28877023-28877045 CCCCCAACCCAGGCCTGGAGAGG - Intergenic
1125015105 15:34925548-34925570 CACCAAAAGGAGGCCAGGAGCGG + Intronic
1125968780 15:43895072-43895094 CAACAAACACAGGCCGGGTGTGG - Intronic
1126077225 15:44923142-44923164 CACAGAAAGCAAGCCAGGAGTGG - Intergenic
1126081490 15:44967723-44967745 CACAGAAAGCAAGCCAGGAGTGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132397464 15:101484679-101484701 CACACAAAGCAGGCCGGGCGTGG - Intronic
1133157875 16:3888566-3888588 AACTGAAAGCAGGCCGGGTGCGG - Intergenic
1134681415 16:16128437-16128459 AACTGAACTCAGGCCGGGTGTGG - Intronic
1137549566 16:49427973-49427995 CACCGAGAGCAGGCTGGGTGGGG - Intergenic
1141867562 16:86761179-86761201 CACCGAAAGCAGGCTTGGTGTGG - Intergenic
1146486841 17:33249780-33249802 CACCAAAGGCAGGGCGGGTGGGG + Intronic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1148813013 17:50306757-50306779 AACCCAACTCAGGCCGGGTGCGG + Intergenic
1151317262 17:73330736-73330758 AACCGAACGCTGGCCAGGTGCGG + Intergenic
1151453396 17:74212700-74212722 TGCCGAACGCAGGCCAGGAGGGG - Intergenic
1152020780 17:77779272-77779294 CACTGAAAGGAGGCAGGGAGGGG - Intergenic
1152504813 17:80741816-80741838 CACCGAACGCAGGCCTCGACTGG - Intronic
1152795147 17:82302911-82302933 CCCATAATGCAGGCCGGGAGAGG - Intergenic
1152870881 17:82752406-82752428 CGCCGAACCCGGGCCGGGGGAGG - Intronic
1153457414 18:5295862-5295884 TAGCAAACGCAGGCCGGGACCGG + Exonic
1157578864 18:48761722-48761744 CACCGAACGCAGAGGGGCAGGGG - Intronic
1158139966 18:54244940-54244962 CACCCACCTCAGGCCGGGCGCGG - Intergenic
1159931461 18:74316373-74316395 CACAGAAGCCAGGCCGGAAGAGG + Intronic
1161363494 19:3865037-3865059 CACTGAGCGCAGGCCGGGCACGG - Intronic
1161948256 19:7452345-7452367 CACTGAATTCAGGCCGTGAGAGG + Intronic
1162808274 19:13150202-13150224 CCGCGAACCCAGGCCGGGAGGGG - Exonic
1163666641 19:18606715-18606737 CGCGGGACGCAGGCCGGGCGCGG + Exonic
1164713403 19:30375172-30375194 CAACGAACGCAGGCGGCGGGAGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166248993 19:41552712-41552734 CACCGAATGCAGCACTGGAGTGG + Intronic
1167310605 19:48735495-48735517 CACCCGACGCCGCCCGGGAGCGG + Exonic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
930506511 2:52288133-52288155 CACCGAATGCAGTGCTGGAGTGG + Intergenic
933486532 2:82931871-82931893 CACCCAACTCAGGCTGGGTGTGG + Intergenic
935012011 2:99144309-99144331 AACGGAACACAGGCCGGGCGCGG - Intronic
935211827 2:100945283-100945305 CACTGACTGCAGGCAGGGAGGGG + Intronic
935239141 2:101163327-101163349 GACCGAACCCAGGCCAGGCGCGG + Intronic
936159383 2:110072135-110072157 CTCCGCGCGAAGGCCGGGAGGGG - Intergenic
936185278 2:110299197-110299219 CTCCGCGCGAAGGCCGGGAGGGG + Intergenic
937409132 2:121657500-121657522 CACAGAACGCAGGCTGGGCATGG - Intergenic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
946304495 2:218848007-218848029 AACTCAAAGCAGGCCGGGAGCGG + Intergenic
946432242 2:219632021-219632043 TCCCGGACGCAGGGCGGGAGGGG + Exonic
948537605 2:238657857-238657879 CAGCCCACACAGGCCGGGAGAGG + Intergenic
948610628 2:239164066-239164088 CAAAGAACCAAGGCCGGGAGGGG + Intronic
1169261939 20:4145642-4145664 CACCCAAAACAGGCCGGGCGCGG + Intronic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1174015185 20:47482185-47482207 CACAGAATTCAGGCTGGGAGTGG - Intergenic
1175521537 20:59605212-59605234 CCCCGAATGCAGGCGGGGCGCGG - Intronic
1176164317 20:63664815-63664837 CACAGGACGCAGGCCAGGAAGGG - Intronic
1176187988 20:63791979-63792001 CACAGAACGCCGGCTGGGGGAGG - Intronic
1177326935 21:19602720-19602742 CACCACACGCAGGCCGGGCATGG + Intergenic
1177894476 21:26844091-26844113 GACAGAACGGAGGCCTGGAGTGG - Intronic
1178916417 21:36707920-36707942 CACCGCACTCAGGACGGCAGTGG + Intronic
1179928250 21:44550316-44550338 CTCCGCACCCAGGGCGGGAGGGG - Intronic
1179939435 21:44628397-44628419 CTCCGCACCCAGGGCGGGAGGGG + Intronic
1181963881 22:26643086-26643108 CACCACCCGCAGGCCGGGTGGGG - Intergenic
1184206661 22:43008537-43008559 CACTGAACTTAGGCCGGGCGTGG - Intronic
953883057 3:46701405-46701427 CACCGAGCGCCGGCTGGCAGGGG + Exonic
953974101 3:47369777-47369799 AACGGGACGCAGGCCGGGCGCGG + Intergenic
960045091 3:113189518-113189540 CATCGAACCTAGGCAGGGAGAGG - Intergenic
962199214 3:133387988-133388010 CACAGAACACAGGCTGGCAGGGG - Intronic
962545395 3:136429114-136429136 AACAGAGCGCAGGCTGGGAGAGG + Intronic
968636290 4:1682029-1682051 CAAGGAACCCAGGCCTGGAGAGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
972325884 4:38014801-38014823 CAGCGAGCGCAGGCCGGGCTGGG - Exonic
984278458 4:177638394-177638416 CAGGGAACCCATGCCGGGAGTGG - Intergenic
989630492 5:43477296-43477318 CACCAGACACAGGCCGGGGGCGG + Intronic
992240787 5:74767256-74767278 CACACCACGCAGGCCGGGACAGG - Exonic
999267922 5:150278905-150278927 CACAGAATGTAGGCAGGGAGGGG + Intronic
1001092718 5:168753035-168753057 CACCGAACTCAGGCCGGCAAAGG + Exonic
1001481330 5:172091143-172091165 CATGGAACACAGGCCGGGAGTGG - Intronic
1002507149 5:179687391-179687413 CACAGAGCACAGGCCGGGCGCGG - Intronic
1007486012 6:42181244-42181266 TACCCAACTCAGGCCGGGCGCGG + Intergenic
1007572658 6:42904388-42904410 CTCTGAATGCAGGCTGGGAGTGG + Intergenic
1012549859 6:100456280-100456302 CACCGAAGGCAGGAGGCGAGGGG - Intronic
1013548072 6:111179818-111179840 CACCGAATGCAGCACGGTAGAGG + Intronic
1017823436 6:158064793-158064815 CCCAGACCGCAGGCCGTGAGGGG - Intronic
1019530941 7:1503082-1503104 CTCAGAAGGCAGGCCGGAAGGGG + Exonic
1024076937 7:45825943-45825965 CACCAAATTCAGGCCGGGTGTGG - Intergenic
1025127484 7:56355474-56355496 CACCAAATTCAGGCCGGGTGTGG + Intergenic
1029112895 7:98222653-98222675 CACCGAGATCAGGCCGGGTGGGG - Intronic
1032423605 7:131802623-131802645 CACTGAATGCAGGCAGGAAGAGG + Intergenic
1032775965 7:135113065-135113087 CACTGAATGTAGGCCGGGTGTGG - Intronic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1034951164 7:155297909-155297931 CTCCGAACGGAGGCGGGGCGGGG - Exonic
1035106240 7:156443775-156443797 CCCTGAGCGCAGGCCAGGAGTGG - Intergenic
1035231995 7:157470717-157470739 CACCCAACGCAGGCCAGCACCGG - Intergenic
1035276858 7:157753088-157753110 CCCTGCACGCAGGCCTGGAGAGG - Intronic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1040891674 8:52323781-52323803 CACTGAAGACAGGCCGGAAGTGG - Intronic
1041739069 8:61139543-61139565 GACCGAGCGGAGGCCGGGGGCGG + Intronic
1046840108 8:118846911-118846933 GACTGAACACAGGCCGGGCGCGG + Intergenic
1049603904 8:143520349-143520371 CACCGCATGCAGGGCTGGAGTGG - Intronic
1052896214 9:33750540-33750562 CCCCGCACGCTGGCCGGGACCGG + Exonic
1056615143 9:88159378-88159400 CACAGACCACAGGCCGGGCGTGG - Intergenic
1057594880 9:96407179-96407201 CACGCCACGCAGGCCGGGACAGG - Intronic
1061149940 9:128822886-128822908 CACTGAAGACAGGCTGGGAGCGG - Intronic
1061735681 9:132655930-132655952 CACTGAACGCAGGCTAGGAATGG + Intronic
1185619847 X:1447139-1447161 CACCAAACACAGCCCTGGAGGGG - Intronic
1186768187 X:12791889-12791911 CACCGCTGGGAGGCCGGGAGCGG - Intronic
1189426192 X:40903438-40903460 GACCGAATGCTGGCCGGGCGTGG + Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1196650837 X:118166629-118166651 CACAGAACTCAGGCCAGGCGCGG - Intergenic