ID: 942653982

View in Genome Browser
Species Human (GRCh38)
Location 2:178195256-178195278
Sequence GCTGCAGGGGCGCCAGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942653982_942653994 12 Left 942653982 2:178195256-178195278 CCCGCTGCTGGCGCCCCTGCAGC No data
Right 942653994 2:178195291-178195313 CTCCGTCCACTCCCCCGGCCAGG No data
942653982_942653992 7 Left 942653982 2:178195256-178195278 CCCGCTGCTGGCGCCCCTGCAGC No data
Right 942653992 2:178195286-178195308 GCAGCCTCCGTCCACTCCCCCGG No data
942653982_942653995 13 Left 942653982 2:178195256-178195278 CCCGCTGCTGGCGCCCCTGCAGC No data
Right 942653995 2:178195292-178195314 TCCGTCCACTCCCCCGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942653982 Original CRISPR GCTGCAGGGGCGCCAGCAGC GGG (reversed) Intronic
No off target data available for this crispr