ID: 942657169

View in Genome Browser
Species Human (GRCh38)
Location 2:178226064-178226086
Sequence TGGGCCATAAGCAGCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942657162_942657169 12 Left 942657162 2:178226029-178226051 CCGGAGCTAGTAACAGAAGGAAC No data
Right 942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG No data
942657161_942657169 13 Left 942657161 2:178226028-178226050 CCCGGAGCTAGTAACAGAAGGAA No data
Right 942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG No data
942657165_942657169 -10 Left 942657165 2:178226051-178226073 CCAATACCTTTTCTGGGCCATAA No data
Right 942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942657169 Original CRISPR TGGGCCATAAGCAGCAAGGG AGG Intronic
No off target data available for this crispr