ID: 942657439

View in Genome Browser
Species Human (GRCh38)
Location 2:178229024-178229046
Sequence CACGAGGCCCTCATCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942657439_942657443 8 Left 942657439 2:178229024-178229046 CCACATCTGATGAGGGCCTCGTG No data
Right 942657443 2:178229055-178229077 CAGCATGGCAGAAAAGTGGAAGG No data
942657439_942657444 14 Left 942657439 2:178229024-178229046 CCACATCTGATGAGGGCCTCGTG No data
Right 942657444 2:178229061-178229083 GGCAGAAAAGTGGAAGGTCATGG No data
942657439_942657442 4 Left 942657439 2:178229024-178229046 CCACATCTGATGAGGGCCTCGTG No data
Right 942657442 2:178229051-178229073 TTCACAGCATGGCAGAAAAGTGG No data
942657439_942657445 15 Left 942657439 2:178229024-178229046 CCACATCTGATGAGGGCCTCGTG No data
Right 942657445 2:178229062-178229084 GCAGAAAAGTGGAAGGTCATGGG No data
942657439_942657441 -7 Left 942657439 2:178229024-178229046 CCACATCTGATGAGGGCCTCGTG No data
Right 942657441 2:178229040-178229062 CCTCGTGCTGCTTCACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942657439 Original CRISPR CACGAGGCCCTCATCAGATG TGG (reversed) Intronic
No off target data available for this crispr