ID: 942658636

View in Genome Browser
Species Human (GRCh38)
Location 2:178240888-178240910
Sequence CTCAGATAGTATCCTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942658632_942658636 -1 Left 942658632 2:178240866-178240888 CCCCAGGGGCCTATTCATAGTTC No data
Right 942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG No data
942658635_942658636 -10 Left 942658635 2:178240875-178240897 CCTATTCATAGTTCTCAGATAGT No data
Right 942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG No data
942658634_942658636 -3 Left 942658634 2:178240868-178240890 CCAGGGGCCTATTCATAGTTCTC No data
Right 942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG No data
942658633_942658636 -2 Left 942658633 2:178240867-178240889 CCCAGGGGCCTATTCATAGTTCT No data
Right 942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG No data
942658628_942658636 19 Left 942658628 2:178240846-178240868 CCACTATCATTACTAATTGTCCC No data
Right 942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942658636 Original CRISPR CTCAGATAGTATCCTAATTT TGG Intronic
No off target data available for this crispr