ID: 942662581

View in Genome Browser
Species Human (GRCh38)
Location 2:178281994-178282016
Sequence CTGTGTGTACTCCGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942662581_942662586 22 Left 942662581 2:178281994-178282016 CCTGCTTCCCGGAGTACACACAG No data
Right 942662586 2:178282039-178282061 ACACATAAAACTGTAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942662581 Original CRISPR CTGTGTGTACTCCGGGAAGC AGG (reversed) Intronic
No off target data available for this crispr