ID: 942665183

View in Genome Browser
Species Human (GRCh38)
Location 2:178310105-178310127
Sequence CCTTCTATGAAAAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942665178_942665183 14 Left 942665178 2:178310068-178310090 CCCCTGTAAGATTTGATTGTTAC No data
Right 942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG No data
942665179_942665183 13 Left 942665179 2:178310069-178310091 CCCTGTAAGATTTGATTGTTACA No data
Right 942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG No data
942665180_942665183 12 Left 942665180 2:178310070-178310092 CCTGTAAGATTTGATTGTTACAA No data
Right 942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942665183 Original CRISPR CCTTCTATGAAAAAATTGGA AGG Intronic
No off target data available for this crispr