ID: 942668003

View in Genome Browser
Species Human (GRCh38)
Location 2:178342708-178342730
Sequence TTTTAAATGAAGTAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942668001_942668003 4 Left 942668001 2:178342681-178342703 CCATTATGCAGTAACAATTTGGC No data
Right 942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG No data
942667999_942668003 29 Left 942667999 2:178342656-178342678 CCTGGTTCGAATAAAAATCTCAG No data
Right 942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942668003 Original CRISPR TTTTAAATGAAGTAAGAGGA AGG Intronic
No off target data available for this crispr